ID: 1179363866

View in Genome Browser
Species Human (GRCh38)
Location 21:40737806-40737828
Sequence CCTCAGAAGGGGCTCTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179363858_1179363866 3 Left 1179363858 21:40737780-40737802 CCTGGCCACATCCAGCATCCAGC 0: 1
1: 0
2: 4
3: 31
4: 324
Right 1179363866 21:40737806-40737828 CCTCAGAAGGGGCTCTTGAGTGG 0: 1
1: 0
2: 2
3: 28
4: 184
1179363859_1179363866 -2 Left 1179363859 21:40737785-40737807 CCACATCCAGCATCCAGCTGACC 0: 1
1: 0
2: 2
3: 43
4: 260
Right 1179363866 21:40737806-40737828 CCTCAGAAGGGGCTCTTGAGTGG 0: 1
1: 0
2: 2
3: 28
4: 184
1179363860_1179363866 -8 Left 1179363860 21:40737791-40737813 CCAGCATCCAGCTGACCTCAGAA 0: 1
1: 0
2: 2
3: 34
4: 360
Right 1179363866 21:40737806-40737828 CCTCAGAAGGGGCTCTTGAGTGG 0: 1
1: 0
2: 2
3: 28
4: 184
1179363857_1179363866 9 Left 1179363857 21:40737774-40737796 CCAGAGCCTGGCCACATCCAGCA 0: 1
1: 0
2: 2
3: 25
4: 270
Right 1179363866 21:40737806-40737828 CCTCAGAAGGGGCTCTTGAGTGG 0: 1
1: 0
2: 2
3: 28
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179363866 Original CRISPR CCTCAGAAGGGGCTCTTGAG TGG Intronic
900500282 1:3001164-3001186 CCTGTGAAGGGGATCTTGAGGGG + Intergenic
900507521 1:3037134-3037156 CCTCACAGGAGGCTATTGAGTGG + Intergenic
901024499 1:6271943-6271965 CTGCAGGAGGGGCTCCTGAGAGG - Intronic
901229362 1:7633418-7633440 CCCCAGAAGGGGCCCAGGAGGGG - Intronic
902675009 1:18002634-18002656 CGTCAGGAGGGGCTGTTGAGAGG + Intergenic
903749661 1:25613256-25613278 CCTCAGAGAGGGCTGTTGCGAGG + Intergenic
904719773 1:32499291-32499313 CCTGAGAAGGGGCCCTGGAGAGG + Intronic
905181301 1:36168653-36168675 CCTCAGCTGGGGCTCTTGCCTGG + Intronic
905392184 1:37643729-37643751 CCTCAGAAGGGACTGTGGATGGG + Intergenic
906390161 1:45408165-45408187 CATGAGAAGGGGCTCATGAGAGG + Intronic
907254991 1:53172382-53172404 CCTCGGAAGGGGTTCCTGAGAGG + Intergenic
907334805 1:53693177-53693199 TCTCAGAAGGGGCTGTAGGGAGG - Intronic
907586273 1:55620720-55620742 CCTCAGTAGGGACTCTTTGGGGG - Intergenic
907963024 1:59300083-59300105 CATCAGTAGGTGTTCTTGAGTGG + Intronic
909938267 1:81580079-81580101 CCTCATAAGGGGCTCGTTTGTGG + Intronic
911321131 1:96415206-96415228 CCTGAGAATGGGCTCTAGGGGGG + Intergenic
912466488 1:109878317-109878339 CCTCTTAAGGGGCTCTTGCCAGG + Intergenic
915508667 1:156373503-156373525 CCTCTAAAGGGGATGTTGAGAGG + Intronic
918156324 1:181850068-181850090 CCTCAGATGGGGTTTTTGTGGGG - Intergenic
921663632 1:217839246-217839268 CTTCAGAAGAGGCTGATGAGAGG - Intronic
921962338 1:221048409-221048431 CTTCAGATGGGGTTTTTGAGTGG - Intergenic
1063983650 10:11478209-11478231 CCTAAGCAGGGGCTCTGCAGAGG - Intronic
1065100007 10:22322243-22322265 CCGAAGAAAGGGCTCTGGAGGGG + Intronic
1066159778 10:32715372-32715394 CCTCAGATGGGGTTTTTGCGTGG - Intronic
1067214718 10:44292907-44292929 CCTCAGGAGGGCCTCGGGAGTGG + Exonic
1067287149 10:44914922-44914944 CCTCAGCAGGGGCTGGGGAGTGG - Intronic
1067781117 10:49208277-49208299 GCACAGAACGAGCTCTTGAGTGG + Intergenic
1069369377 10:67730454-67730476 CCTCAGAAAGGGCACAGGAGAGG - Intergenic
1069895315 10:71676901-71676923 GCTCAGATGAGGCTCCTGAGGGG + Intronic
1070796575 10:79220327-79220349 CCACAGAAGGGGCCTTAGAGAGG - Intronic
1071298394 10:84238945-84238967 CCTTAGAAGGGCCTGTTCAGTGG - Intronic
1076291519 10:129349330-129349352 TCTCAGAAGGGGCTGCAGAGGGG + Intergenic
1076320882 10:129580563-129580585 CCTCAGACCTGGCTCCTGAGAGG + Intronic
1076995280 11:294669-294691 ACCCAGAGGGGGCTCTGGAGCGG - Exonic
1077005180 11:351635-351657 CCTCAGGAGGGGCTCCAGTGCGG - Intergenic
1078270142 11:9787597-9787619 GCTCAGAAGTGGCTCTCAAGGGG + Intronic
1082009740 11:47441980-47442002 CTTCAGAGGGGTCTGTTGAGGGG - Intronic
1083488120 11:62996186-62996208 TCTCAAAAGGGGCTCTGGAGTGG - Intronic
1083620863 11:64048780-64048802 GCTCAGAATGGGTTCTGGAGTGG - Intronic
1083730682 11:64650872-64650894 CCTCAGAAGAGGAGCTAGAGGGG + Intronic
1085198915 11:74689632-74689654 GCTCAGCTGGGGCTGTTGAGTGG + Intergenic
1086907215 11:92432429-92432451 CATCAGATGGGGTTTTTGAGTGG + Intronic
1089618596 11:119709452-119709474 CCACAGAAAGGACTCTTTAGAGG - Intronic
1089957370 11:122584220-122584242 CCTCACCAGTGCCTCTTGAGGGG + Intergenic
1090234369 11:125136399-125136421 ACTCAGAAGGGGGTCCTGGGAGG + Intergenic
1091188819 11:133672194-133672216 GCTCAGAAGGGCCTCTTGACCGG - Intergenic
1091962813 12:4712879-4712901 CCTCAGAGGGGTCTCTGAAGGGG - Intronic
1092443059 12:8526854-8526876 CCTTAGATGGGGCTTTTGTGGGG + Intergenic
1094461864 12:30704700-30704722 CCTAAGATGGGGCTCTGGACCGG + Intergenic
1098052999 12:66473495-66473517 CCTCAAATGGGTCCCTTGAGGGG + Intronic
1100670739 12:96809873-96809895 TCTGAGAAGGGGCTGTTGTGGGG + Intronic
1106025911 13:25954821-25954843 CTTCAGATGGGGTTTTTGAGTGG - Intronic
1106537453 13:30660025-30660047 TCTCAGACGGGGCCCTGGAGAGG + Intronic
1106972370 13:35157249-35157271 CCTTGGAATGGGCTATTGAGAGG - Exonic
1107010331 13:35664172-35664194 CCAAAGAAGGGGCTATTCAGGGG + Intronic
1108023256 13:46151002-46151024 CCTCAGCAAGAGCTCTTCAGGGG + Exonic
1108354207 13:49615671-49615693 CCCCAGAAGGGGCTCTTGTAAGG - Intergenic
1114692886 14:24601251-24601273 CCCCAGATGGTGCACTTGAGTGG + Intergenic
1117444567 14:55791390-55791412 CCTCAGAAAGGGCTACTGAAGGG + Intergenic
1118186791 14:63544728-63544750 TCCCAGAAATGGCTCTTGAGTGG + Intergenic
1119513301 14:75228572-75228594 ACTGAGAAAGGGCCCTTGAGAGG + Intergenic
1120891583 14:89496471-89496493 CCTCAGAGAGGGCCCTGGAGTGG + Intronic
1121260208 14:92560291-92560313 CCTCAGAAGGGGGTGGTGAGTGG - Intronic
1121342063 14:93111397-93111419 GCTCAGAAGGGGCTTCAGAGGGG - Intronic
1121396029 14:93624131-93624153 CCTTAGAAGTGGCTTTTGTGTGG - Intronic
1121582403 14:95040704-95040726 CCTCAGCATGGTCTCTTGAGGGG - Intergenic
1121714945 14:96067135-96067157 GCCCAGAAGGGGCTCAGGAGAGG + Intronic
1122037862 14:98961492-98961514 CCTGAGGAGGGGCCCTGGAGGGG - Intergenic
1123429139 15:20199999-20200021 CCTCAGATGGGGTTTCTGAGTGG + Intergenic
1124675228 15:31678805-31678827 CCTCAGTGGGGACTCTTGTGTGG - Intronic
1124690397 15:31816874-31816896 TCTCAGCAAGGGCACTTGAGAGG + Intronic
1129637501 15:77336395-77336417 ACTCAGAAGGGACTCCTGAGTGG - Intronic
1132354756 15:101163025-101163047 CACCAGAAATGGCTCTTGAGAGG - Intergenic
1132385660 15:101398222-101398244 TCTGAGAAGTGGCTCTTGACCGG - Intronic
1132614961 16:835816-835838 GCTCAGAAGGGGCTTTTCAGGGG + Intergenic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1134247196 16:12548619-12548641 CAGCAGAAGAGGCTCTTCAGGGG + Intronic
1136231667 16:28889202-28889224 CCTCTGAATGGGCTATTGTGAGG - Intronic
1136687423 16:32003450-32003472 CCTGAGAAGGGGCTCTAGGATGG - Intergenic
1136788037 16:32947001-32947023 CCTGAGAAGGGGCTCTAGGATGG - Intergenic
1136881748 16:33906788-33906810 CCTGAGAAGGGGCTCTAGGATGG + Intergenic
1137584135 16:49653940-49653962 CCACAGAAAGGGCTCTGCAGAGG - Intronic
1137585244 16:49660448-49660470 CCTTACAGGGGCCTCTTGAGTGG - Intronic
1140703747 16:77606665-77606687 CTTCAGAAGGAACTCTTGAATGG + Intergenic
1140916905 16:79502126-79502148 CACGACAAGGGGCTCTTGAGAGG - Intergenic
1203090262 16_KI270728v1_random:1208658-1208680 CCTGAGAAGGGGCTCTAGGATGG - Intergenic
1142596015 17:1030390-1030412 CCTCAGCAGGGGCTGGGGAGGGG + Intronic
1144575662 17:16427906-16427928 CCCCAGTAGGGCCTCTTCAGTGG + Intronic
1146724523 17:35146958-35146980 CCTCAGAAGGGGGTCTTCCTGGG - Intergenic
1147148404 17:38499119-38499141 CCTGAGAAGGGGCTTTAGAATGG - Intronic
1147488481 17:40841463-40841485 CCTCAGAAGAGGCCCCTGAAAGG - Intergenic
1147664849 17:42140042-42140064 TCTCAAAAGGGGCTCTGCAGGGG + Intronic
1148618021 17:49014537-49014559 CCACAGAGAGGGCACTTGAGGGG + Intronic
1151302318 17:73236253-73236275 CATCAGTAGGGACTCCTGAGAGG - Exonic
1152659012 17:81533926-81533948 CCGCAGGAGGGGCCCATGAGAGG - Intronic
1153085184 18:1278224-1278246 CTTCAGAAGGAAGTCTTGAGAGG + Intergenic
1153272288 18:3334347-3334369 CATCAACAGGGGCTCTTGAGGGG + Intergenic
1153704086 18:7727177-7727199 TGTAAGAAGGGGCTCTTGAATGG + Intronic
1153796131 18:8623951-8623973 AGTCAGATGAGGCTCTTGAGGGG - Intronic
1156095170 18:33522085-33522107 CTTCAGAAGGGGCCCCTGAAGGG + Intergenic
1156185602 18:34659728-34659750 CTTCAGAAAGGGCTGGTGAGAGG - Intronic
1156284620 18:35679605-35679627 CCTGAGCAGGGACTCTGGAGCGG - Intronic
1156778574 18:40822624-40822646 CCTTGGAAGGGGCTGTTGTGGGG - Intergenic
1159519050 18:69495447-69495469 CCTCAGAGGAGGCCCTGGAGTGG + Intronic
1160344609 18:78123155-78123177 TCTCAGACGGGTCTCTGGAGAGG + Intergenic
1160715983 19:577004-577026 CCTCAGAAGGTGCTGTGGGGAGG + Intronic
1161572196 19:5036660-5036682 CCTCACACGGGGCTCCTGGGGGG - Intronic
1164509394 19:28885223-28885245 CCTCTGATGGGGCTCTGGACAGG - Intergenic
1167895499 19:52577633-52577655 CCGCATAAGGGCCGCTTGAGGGG + Intronic
1167927778 19:52835383-52835405 CCGCATAAGGGCCGCTTGAGGGG - Intronic
1167939087 19:52931922-52931944 CCGCATAAGGGCCGCTTGAGGGG + Intronic
924992066 2:320755-320777 TCTCGGAAGTGGCTCTGGAGAGG + Intergenic
927256614 2:21045030-21045052 ACTCAGAAGGGGTTATTGATGGG + Intergenic
929666104 2:43835189-43835211 CAGCAGGAGGGGCTCTTGATTGG - Intronic
929754123 2:44749773-44749795 GCTCAGAGGGGGCTGTTGCGTGG - Intronic
930897864 2:56466126-56466148 CCTTACAAGGGGGTCTTAAGGGG + Intergenic
933435727 2:82247194-82247216 CCTCAGATCGGGCTTTTGACAGG - Intergenic
939652918 2:144786248-144786270 CCTCAGATGGGGTTGTTGTGCGG - Intergenic
939962558 2:148578277-148578299 CCTCAGTGGGGGCTGCTGAGAGG + Intergenic
943352096 2:186807433-186807455 TCTCAGAAGGGCCTGTTTAGAGG - Intergenic
948312249 2:236996731-236996753 CCTCAGCTGAGGATCTTGAGAGG + Intergenic
948505732 2:238426098-238426120 CCTCAGCAGGGGCACTCGCGGGG + Intergenic
948575505 2:238947106-238947128 CCTGGGAAGGCACTCTTGAGGGG - Intergenic
948890877 2:240906551-240906573 CCCCAGTAGGGGCTGTTGGGAGG - Intergenic
1170172451 20:13430453-13430475 CCTCAGAAGCAGCTGTTGGGAGG + Intronic
1170864284 20:20139232-20139254 CCTTAAAAAGGGCTCTTGAATGG - Intronic
1172167332 20:32907258-32907280 CCATAGAATGGGCTGTTGAGTGG + Intronic
1173518516 20:43682289-43682311 CCTGAGAAGGAGGTCCTGAGGGG - Intronic
1176156627 20:63625471-63625493 ACACAGAAGGGGCTGTGGAGAGG - Intronic
1178926743 21:36782223-36782245 CCTCAGAAGGAGTACTTCAGTGG - Intronic
1179363866 21:40737806-40737828 CCTCAGAAGGGGCTCTTGAGTGG + Intronic
1179886750 21:44317439-44317461 ACTCTGAAGAGCCTCTTGAGGGG + Intronic
1182896082 22:33860639-33860661 CCTCAGAGGGGGCTCTTCTGAGG + Intronic
1183717361 22:39541262-39541284 CCTCAGAAGGGCCTCATGCTTGG - Intergenic
1183964262 22:41431900-41431922 CCTCTGCAGGGCCTGTTGAGCGG - Intergenic
950364916 3:12476123-12476145 CCTCAGAGGGGGCTGTTATGGGG - Intergenic
950810759 3:15647968-15647990 CCTCAGCAGGGGCTCTGGACAGG - Intergenic
953291098 3:41663837-41663859 TCTGAGAAGGGGCACATGAGAGG - Intronic
954439171 3:50512151-50512173 CCCCAGAAGGGGTGCTTGGGAGG + Intergenic
954975389 3:54689242-54689264 GCTGAGAAGAGGCTCGTGAGAGG - Intronic
961339393 3:126207358-126207380 CCTCAGTGGGGGCTCTTCACTGG + Intergenic
965730538 3:171767587-171767609 CATCAGAAGGTGCTGTGGAGGGG - Intronic
968502860 4:959268-959290 CCTCAGAAGTGGCTCTGGTTTGG - Exonic
970178332 4:13361962-13361984 CCTCAGAAGGGGCAATTGAAGGG + Intronic
971376700 4:26061623-26061645 CCTCAAATGGGATTCTTGAGAGG - Intergenic
971473262 4:27049742-27049764 CCTCAGAAATGGCACATGAGAGG + Intergenic
978227148 4:106350506-106350528 CCTCAAAAGGAGCTTTTAAGGGG - Intergenic
978816298 4:112910244-112910266 CCTCAGCTGGGGCTGTTCAGTGG + Intronic
981781285 4:148433150-148433172 CATCAGGAGGGCTTCTTGAGTGG + Intronic
983625799 4:169800868-169800890 ACTGAGAAGGAGCACTTGAGGGG - Intergenic
984618752 4:181928001-181928023 CTTCAGAAGGGGTTTTTGTGTGG - Intergenic
984734264 4:183096405-183096427 CCACAGAATAGGCTCTTCAGCGG + Intergenic
985588605 5:753452-753474 CCTCAGGAGGGGTGCTGGAGAGG - Intronic
985603274 5:845891-845913 CCTCAGGAGGGGTGCTGGAGAGG - Intronic
985618112 5:936828-936850 CCACAGAAGGGGGTCTCTAGGGG - Intergenic
985628031 5:1000184-1000206 CCTCCTAAGGGGCTCCTAAGGGG + Intergenic
987809599 5:22817047-22817069 CCTAAGGAGAGGCTATTGAGAGG - Intronic
993678864 5:90850344-90850366 CCTCACATGGGGCTTTTGAAAGG + Intronic
993911661 5:93690998-93691020 CTTCAGAAGGGGTTTTTGTGTGG - Intronic
995119097 5:108517043-108517065 CCCCAGAAAGTGCTCTTTAGGGG - Intergenic
995589355 5:113683062-113683084 CCTGGGAACGGGCTCTGGAGAGG - Intergenic
1001073654 5:168607681-168607703 CCTAAGAAGGGGCTATTTAAAGG - Intergenic
1001253346 5:170165288-170165310 CCTCAGAAGGGGAGCTGCAGAGG + Intergenic
1001443199 5:171762024-171762046 CCTGAGAATGGGATCTTGGGAGG - Intergenic
1003573051 6:7268570-7268592 CCTCAGGAGGGGCGGTGGAGGGG - Intronic
1004141645 6:13023516-13023538 CCTCAGCAGAGGCTCTTGGGGGG + Intronic
1006118899 6:31792170-31792192 ACTTAGAAGGGGCTGCTGAGGGG + Intronic
1006400024 6:33812406-33812428 CATCAGAAAGGGCTCTTAAGAGG + Intergenic
1007858251 6:44879901-44879923 CTTCAGATGGGGCTTTTGAGTGG - Intronic
1007992435 6:46270721-46270743 CATCAGAAGAGGCCATTGAGAGG - Intronic
1008864094 6:56188939-56188961 CTTCAGATGGGGTCCTTGAGTGG - Intronic
1009684984 6:66945228-66945250 CCTCAGAAGTGGCTCTGGTTTGG + Intergenic
1011172591 6:84522380-84522402 CCTCAGAAATGACTCATGAGAGG + Intergenic
1014710127 6:124796618-124796640 CCACAGCAGGAGATCTTGAGCGG - Intronic
1015858136 6:137647492-137647514 CCTCACAAGGGGCAGTTGTGAGG + Intergenic
1017234439 6:152104874-152104896 CCTCTGGAGAGGCTCTTGAGAGG + Intronic
1017266336 6:152450598-152450620 CCTCAGAATGGCCTCCAGAGAGG - Intronic
1017815083 6:158010646-158010668 CCTCAGAAGGGGATCTTATTTGG + Intronic
1019183490 6:170207687-170207709 CCTCAGAGGGGACTCGGGAGAGG - Intergenic
1019295645 7:272618-272640 GCTGAGGAGGGGCTCTTGTGAGG - Intergenic
1020261361 7:6532252-6532274 CCTGGGGAGGGGCTCTTCAGGGG + Intronic
1021484915 7:21157282-21157304 CCTCAGGATGGGCTCTGGAGTGG - Intergenic
1022239605 7:28497211-28497233 CTTCAGATGGGGCTCCTTAGAGG - Intronic
1022257368 7:28672746-28672768 ACTCAGAAGGGGGTCTGGAGTGG + Intronic
1023479770 7:40621570-40621592 GATCAGAAGGGGCTCTGGTGAGG + Intronic
1024975793 7:55112573-55112595 CCTCAGAAGGCCCTGTGGAGTGG + Intronic
1027582990 7:80021097-80021119 CTTCAGATGGGGTTTTTGAGTGG - Intergenic
1029610742 7:101625340-101625362 CCCCAGAATGGGCTCTCGATGGG + Intronic
1030096735 7:105907257-105907279 GCTCAGAAAGAGCTCTTTAGAGG + Intronic
1038211688 8:25524017-25524039 CTTCAGACGGGGTTTTTGAGTGG - Intergenic
1040900735 8:52414769-52414791 CCTGAGAAATGGCTCTGGAGGGG - Intronic
1041705154 8:60838832-60838854 CCTCAGAAGGGGCTCTCAGGTGG - Intronic
1042311350 8:67381920-67381942 CCAAAGAAGGGGCTCCTGAGTGG + Intergenic
1042486426 8:69351225-69351247 ACTCAGAAGGGTCTCTTGCTTGG - Intergenic
1044009346 8:86973017-86973039 CCTCAGAAGGGACACTTAAGTGG - Intronic
1049182859 8:141231851-141231873 CCTCACCAGGCGCTGTTGAGAGG - Intronic
1053417046 9:37953384-37953406 TCTCAGCAGGGGCAGTTGAGAGG + Intronic
1055215863 9:73861250-73861272 CCCCAGAAGGGGCTTTTCTGAGG - Intergenic
1055354873 9:75427536-75427558 CATGAGAAGGAGCTTTTGAGGGG - Intergenic
1056663703 9:88563585-88563607 CCTCAGAAGGCTCATTTGAGTGG - Intronic
1057409101 9:94800870-94800892 CCGCAGAAGGGTCTCTTGGCAGG - Exonic
1058382474 9:104392592-104392614 CTTCAGATGGTGCTCTTGATAGG - Intergenic
1058641075 9:107086068-107086090 CCTCAGCAGGGGCTCGGGAAGGG - Intergenic
1058835658 9:108856652-108856674 AGTCAGAAGGTGCTCTAGAGAGG + Exonic
1061322305 9:129838991-129839013 ACTCAGAAGAGGCTCTTGTGAGG + Intronic
1062152859 9:135030851-135030873 CCTGAGAAGGGGCTTTGGTGAGG - Intergenic
1185792111 X:2935035-2935057 TCTCAGAAGGGTCTCTTGAGAGG + Exonic
1185911266 X:3982973-3982995 CTTCAGATGGGGTCCTTGAGTGG - Intergenic
1189930811 X:46007596-46007618 TCTTTGAAGGGGCTCTTGTGAGG - Intergenic
1191155860 X:57271720-57271742 CTTCAGATGGGGCATTTGAGTGG - Intergenic
1194610275 X:96035075-96035097 CCTCAGGAGAGGGTCTTGAGGGG - Intergenic
1199871270 X:151900987-151901009 CCTCAGAAGGAGCTGGAGAGGGG + Intergenic
1199885298 X:152015338-152015360 ACTCAGAAGGTGTTGTTGAGTGG + Intergenic
1201281572 Y:12347268-12347290 TCTCAGAAGGGTCTCTTGAGAGG - Intergenic
1201465003 Y:14270578-14270600 CTTCAGATGGGGTTCTTGAGTGG - Intergenic