ID: 1179368621

View in Genome Browser
Species Human (GRCh38)
Location 21:40782910-40782932
Sequence ACTTTAACATGACTGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179368617_1179368621 26 Left 1179368617 21:40782861-40782883 CCACTTATTTTTGTATGGTAAAT No data
Right 1179368621 21:40782910-40782932 ACTTTAACATGACTGCCCTGAGG No data
1179368616_1179368621 30 Left 1179368616 21:40782857-40782879 CCTTCCACTTATTTTTGTATGGT No data
Right 1179368621 21:40782910-40782932 ACTTTAACATGACTGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179368621 Original CRISPR ACTTTAACATGACTGCCCTG AGG Intronic