ID: 1179372254

View in Genome Browser
Species Human (GRCh38)
Location 21:40817315-40817337
Sequence GCTTGTTTCTTCTCTGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179372252_1179372254 18 Left 1179372252 21:40817274-40817296 CCAGGAGGGAAAGGGAAGCAAGC 0: 1
1: 1
2: 1
3: 50
4: 438
Right 1179372254 21:40817315-40817337 GCTTGTTTCTTCTCTGGAACAGG 0: 1
1: 0
2: 1
3: 20
4: 217
1179372249_1179372254 29 Left 1179372249 21:40817263-40817285 CCACATAAATGCCAGGAGGGAAA 0: 1
1: 0
2: 0
3: 22
4: 229
Right 1179372254 21:40817315-40817337 GCTTGTTTCTTCTCTGGAACAGG 0: 1
1: 0
2: 1
3: 20
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179372254 Original CRISPR GCTTGTTTCTTCTCTGGAAC AGG Intronic
900433292 1:2612848-2612870 GCTTGTCACCTCTCTGGACCTGG - Intronic
901771130 1:11530886-11530908 GCTTGTTTCTCCTTGGGAAAGGG + Exonic
903305118 1:22407881-22407903 TCTTCTCTCTTCTCTGGATCAGG - Intergenic
904749707 1:32733959-32733981 GCTTGGTTCTTCTCAGAAACAGG - Intergenic
905048868 1:35031491-35031513 TCTCATTTCTTCTTTGGAACAGG - Intronic
906061612 1:42952774-42952796 GTTTGTTTCTTTCCTTGAACTGG + Intronic
907178817 1:52552755-52552777 ACTTCTTTCTTTCCTGGAACGGG - Intronic
907865316 1:58393769-58393791 GCTTATTTCTTCTGTAAAACTGG - Intronic
908520098 1:64933240-64933262 TCTTTTTTCTTCCCTGGAAAGGG - Intronic
909636049 1:77818453-77818475 CCTTGTGTCTTCTCTGGGTCAGG - Intronic
910292766 1:85615492-85615514 GCTTTACTCTTCTCTGAAACGGG - Intergenic
912668060 1:111600709-111600731 TCTGGTTTCTTCTCTGTAAATGG - Intronic
917963722 1:180165782-180165804 GCTTGTTTCTTCTCAGTTCCTGG + Intronic
919369971 1:196710645-196710667 GCTTGGTTATTCACTAGAACTGG + Intronic
919581352 1:199378450-199378472 GGATGTTTCGTCTCTGAAACTGG - Intergenic
920493870 1:206440271-206440293 GCTGTTTCCTTCCCTGGAACAGG - Intronic
921183515 1:212650879-212650901 GCTTCTGTCTTCTTTGGACCTGG - Intergenic
921271645 1:213475446-213475468 GCTCTTCTCTTCTCTGGACCTGG + Intergenic
921713118 1:218392747-218392769 GCTTTTTACTTCTCTAAAACTGG + Intronic
923596725 1:235366030-235366052 GATTGTTTTTTCTTTGGAAGAGG - Intergenic
923606347 1:235446659-235446681 GCTACTTTCTTCTATAGAACCGG + Intronic
924082844 1:240417555-240417577 ACTTGTTTCAACTCTGGCACTGG - Intronic
924354698 1:243159620-243159642 GCCTGTTTCTTCTCTTTAAATGG - Intronic
924550885 1:245075761-245075783 GTTTGTTTCTTCTATGGGAAGGG - Intronic
1065194548 10:23250454-23250476 GATTCTTTATTCTCAGGAACAGG - Intergenic
1065294318 10:24259886-24259908 TCTTCTTTATTCTGTGGAACTGG + Intronic
1068695913 10:59968070-59968092 GCCTGTTTCTTGTATGGCACTGG + Intergenic
1068738766 10:60445382-60445404 GCTTGTTTGTTTTTTGGCACAGG - Intronic
1069939921 10:71948372-71948394 GCTTGTTTCCCCTGTGGACCCGG + Intergenic
1072260883 10:93671356-93671378 GCCAGTTTCTTCCCTGAAACAGG - Intronic
1075344472 10:121672026-121672048 GCTGGTTTCTGCTCAGGCACTGG - Intergenic
1076178583 10:128387716-128387738 TATTGTTTCTTGTCTGGCACAGG + Intergenic
1077704689 11:4473298-4473320 CCCTGTTTCTTCTCTGGAAATGG - Intergenic
1078445611 11:11402923-11402945 GCTTCTTTCTTCTCTGCCCCAGG + Intronic
1079347474 11:19665498-19665520 GCTTATTTTTTCTAAGGAACTGG + Intronic
1079898743 11:26154620-26154642 GCTTGCTTCTTCTCTGCTTCTGG + Intergenic
1081479534 11:43472335-43472357 TCTTTTTTCTTTTCTGAAACAGG - Intronic
1082090082 11:48081791-48081813 GCTTCTTTCTTCTCCTGAAAGGG + Intronic
1086989783 11:93290322-93290344 AGTTGTTTCTTCCCTGGAACCGG + Intergenic
1088897225 11:114087724-114087746 TCTCGTTTCTTCTCTAGAATAGG - Intronic
1089676233 11:120091820-120091842 GGTAGTTTCTTCACTTGAACTGG + Intergenic
1091805933 12:3355815-3355837 GCCTGTCTTGTCTCTGGAACAGG + Intergenic
1092156540 12:6285629-6285651 GCTTGTTTGTTTTTTGAAACAGG + Intergenic
1095173237 12:39059946-39059968 TCTTGCTTCTTGTCTGGCACAGG - Intergenic
1095612291 12:44144572-44144594 GATTGCTTCTTACCTGGAACAGG + Intronic
1096502567 12:52073845-52073867 GCGTGTCTCTTCTGAGGAACTGG + Exonic
1097583668 12:61489437-61489459 GATAATTTCTTCTCTGAAACAGG - Intergenic
1097961609 12:65536852-65536874 GTTCTTTTCTTCTCTGGGACAGG - Intergenic
1101224220 12:102671448-102671470 GCTTGCCTGTTCTCTGGACCTGG - Intergenic
1101657248 12:106733598-106733620 GCTTTCTTTTTCTCTGGAAAGGG + Intronic
1102559703 12:113753563-113753585 TCTTGAATCTTCTCTGAAACAGG - Intergenic
1102992687 12:117326564-117326586 CCTTGTTTCTCCTCTGAAGCAGG + Intronic
1104719695 12:131038492-131038514 GCATCTTTCTTCTCTGTGACTGG + Intronic
1106056219 13:26240086-26240108 GCTTGCTTTGTCTCTAGAACAGG - Intergenic
1107619425 13:42211020-42211042 TCCTGACTCTTCTCTGGAACAGG - Intronic
1108286391 13:48913311-48913333 ACTTGTTTCTTTTCTGGTCCAGG + Intergenic
1109321589 13:60816937-60816959 GCTTGTGTTTTTTGTGGAACTGG + Intergenic
1110555196 13:76851875-76851897 ACTCGGTTCTTCTCAGGAACAGG + Intergenic
1112541412 13:100317502-100317524 ACCTGTTTCTTCTCTGCAAATGG + Intronic
1113271057 13:108674947-108674969 GCTTGGTGCCACTCTGGAACAGG - Intronic
1113813020 13:113153684-113153706 GCTTGTTTTTCTCCTGGAACTGG - Intergenic
1114476616 14:22999578-22999600 ACATGTCTCTTCTCTGGACCTGG - Intronic
1114775017 14:25472147-25472169 ACTTTCTTCCTCTCTGGAACAGG + Intergenic
1115635900 14:35290161-35290183 GCTGGACCCTTCTCTGGAACTGG - Intronic
1117384620 14:55198698-55198720 GCATGTTTTGTCTCTGGAACTGG + Intergenic
1118151953 14:63199191-63199213 TCTTTTTTCTACTCTGGAAGTGG - Intergenic
1118729953 14:68659185-68659207 GATTGTTTTTCCTGTGGAACAGG - Intronic
1119421332 14:74509512-74509534 GCTTCCCTCTTCTCTGGGACTGG + Intronic
1129711627 15:77823219-77823241 GCTTTTTTCTTCTCTGAAATGGG - Intergenic
1129903714 15:79171513-79171535 CCTCGTGTTTTCTCTGGAACAGG - Intergenic
1133989894 16:10696556-10696578 GCTTCTTTCTGCTGTTGAACTGG + Intergenic
1134137068 16:11684164-11684186 TCTTGTTTTTTCCCTGCAACAGG - Exonic
1138050392 16:53770751-53770773 GCACTTTTCTTCTCTGGCACTGG - Intronic
1139072245 16:63396950-63396972 GCCTTTTTCTTCTCTGAAATTGG - Intergenic
1139973756 16:70792570-70792592 GCTTGTATCTTCTGGGGAATGGG - Intronic
1141676236 16:85518924-85518946 GTGTTTTTCTTCTCTGGACCTGG + Intergenic
1145914023 17:28560272-28560294 ACTTGTTTCTCCTCTGGAATGGG + Intronic
1148883600 17:50754079-50754101 GTTTGTTTCTTCTAGTGAACTGG - Exonic
1149518617 17:57301024-57301046 TCCTGTTTCTTCTCTGGGAGAGG + Intronic
1149965916 17:61163901-61163923 GCTTGTTTCTCCTCTGCCTCTGG + Intronic
1151519271 17:74616794-74616816 GAGTGTTTCTTCTTTGGTACAGG + Intronic
1152669318 17:81592532-81592554 GCTTTTTTCACCTCTGGAATTGG - Intronic
1153639836 18:7147355-7147377 GCTGGGCTCTTCTCTGGAAACGG + Intergenic
1153660388 18:7320633-7320655 GCTTGTTTCTCCTCTCAAAATGG + Intergenic
1155593110 18:27451319-27451341 GCTTATTTCTTGTCTCTAACTGG + Intergenic
1159401920 18:67949466-67949488 GTTTTTTTCCTCTCTAGAACAGG - Intergenic
1160087592 18:75791528-75791550 GTTTGTTTGTTCTTTGAAACGGG - Intergenic
1161126449 19:2560602-2560624 GCTGGATCCTTCTCTGGAGCAGG - Intronic
1161156504 19:2734585-2734607 GCTGGATTGTTCTCTGGGACGGG + Intronic
1164635530 19:29788500-29788522 GCTTTTTTCTTTTTTGAAACAGG - Intergenic
1165138872 19:33687489-33687511 GCCTGTTTTGTCTCTGGAGCTGG - Intronic
1165682228 19:37787875-37787897 ACTTATTTCTTCTCTGAAATTGG - Intronic
926670970 2:15576548-15576570 CCTTCTTTCTTCTCTGAAGCTGG + Intergenic
927075120 2:19570095-19570117 GTTTGTTTCTTCTCTGCCTCAGG - Intergenic
927167918 2:20343934-20343956 GCTTTTTTTTTCTCTGATACTGG - Intronic
929547775 2:42866945-42866967 TTTTGTTTCTTCTCTGAAACTGG - Intergenic
930300744 2:49612421-49612443 GCTAGTTTCTTCTCTGAGCCTGG - Intergenic
930489947 2:52057097-52057119 GCTTGTTTCTGCTCTAGAATAGG - Intergenic
930611307 2:53547140-53547162 ACTTGGTTTTTCTGTGGAACTGG - Intronic
931433245 2:62226471-62226493 TCTTGTTTCTTGCCTAGAACAGG + Intergenic
932007853 2:67945570-67945592 GGTAGTTTCTTCTTTTGAACTGG - Intergenic
932742525 2:74302801-74302823 GCTTTCTTCTTCTCTGGCTCAGG + Intronic
935642986 2:105308256-105308278 GCTTGTCTCTGCTGTGGAGCGGG - Exonic
936984015 2:118290966-118290988 GCTTGTTCCTTCTGTGAAACGGG - Intergenic
938605809 2:132891454-132891476 TCTTACTGCTTCTCTGGAACTGG + Intronic
938964241 2:136373885-136373907 GCTTGTTTTTTCTTTTGATCAGG - Intergenic
940143236 2:150518610-150518632 GTTTGTTTCTTCTCAGGAAGGGG + Intronic
940376840 2:152967262-152967284 GCTTCATTCTTTTCTGGAAATGG - Intergenic
940823888 2:158387964-158387986 GCTGGTCTCTACACTGGAACTGG - Intronic
942698814 2:178679613-178679635 GCTTCCTTCTTCTTGGGAACAGG + Exonic
942766635 2:179465075-179465097 TCTTCTGTCTTCTCTTGAACTGG + Intronic
942846837 2:180437122-180437144 GTTTGATTCTTATCTGGGACTGG - Intergenic
942906373 2:181185619-181185641 GCTTGGTGCTTCTCAGAAACGGG - Intergenic
943322463 2:186462427-186462449 GCTGGTTTCTTCTCTTGACCAGG + Intergenic
944890904 2:204116321-204116343 GCCTGTTTCTTCTCCGTGACTGG + Intergenic
945068975 2:205972352-205972374 GCTTGGTTCTTCCCTGCAGCTGG - Intergenic
946126411 2:217566888-217566910 CATTGTTTCCTCTCTGTAACTGG - Intronic
1169277966 20:4246243-4246265 GCTTGTTTTGTTTCTGGGACTGG - Intronic
1169891831 20:10461781-10461803 GCTTTTTTCCTCTCTGAAACAGG + Intronic
1170234392 20:14086084-14086106 GCTTTTTTCTTCTTTTGAATAGG + Intronic
1170776566 20:19379786-19379808 GCTTGTTTCATCTATGGATTTGG + Intronic
1172321223 20:33996495-33996517 GCCTGTTTCTTCTATAAAACAGG - Intronic
1172492514 20:35351474-35351496 GTTTGTTTCTGCTGTGGAATAGG - Intronic
1172761673 20:37327761-37327783 GGCTGCCTCTTCTCTGGAACTGG + Intergenic
1173013936 20:39208273-39208295 GCTTGTTTCTTATTTGTCACTGG - Intergenic
1173164896 20:40681033-40681055 CTTTGTTTCTTCTCTGGATCTGG - Intergenic
1174267485 20:49342392-49342414 GCTGGTTTCTTGTCTGAATCAGG - Intergenic
1175319255 20:58073734-58073756 GCCTGTTTCTTCTCTAGCAAAGG + Intergenic
1175647146 20:60684480-60684502 GCTTGTTTCTGCTAATGAACTGG + Intergenic
1178040547 21:28636018-28636040 ACTAGTTTCTTCAGTGGAACTGG - Intergenic
1178841680 21:36142776-36142798 TCTTGTAACTTCTCTGTAACAGG + Intronic
1179372254 21:40817315-40817337 GCTTGTTTCTTCTCTGGAACAGG + Intronic
1181115505 22:20630742-20630764 GCTGGCTTCCTCTCTGGATCAGG - Intergenic
1182305886 22:29367876-29367898 GCCTGATTCATCTCTGGAAAGGG + Intronic
1183324229 22:37182827-37182849 GCTGGCTTCTTCTCTGGGCCAGG - Intronic
1184142397 22:42585487-42585509 GCTGATTTCTTATCTGGAAATGG - Exonic
1184203885 22:42988165-42988187 GCTTTTGTGTTCTCTGGAACAGG - Intronic
1184273862 22:43399487-43399509 GGCTCTTTCTTCTCTGGGACTGG + Intergenic
1185418481 22:50722228-50722250 GCTTGGACCTTCTCTGGAAGAGG - Intergenic
951196719 3:19831848-19831870 ACTTATTTCTTCTATCGAACAGG + Intergenic
952384577 3:32830838-32830860 GTTTGTTTTTTTGCTGGAACTGG + Intronic
952604695 3:35131013-35131035 GCTTATTTCTCCTGTGGCACTGG + Intergenic
954040560 3:47883801-47883823 GCCTGTTTCTTATCAGAAACTGG - Intronic
954239818 3:49284792-49284814 GCTGGTTTCTGCTCTGGATGTGG - Intronic
954750765 3:52812308-52812330 TTTTGTTTCTTCTCTGAGACAGG + Intergenic
955808891 3:62765373-62765395 GCTGCTTTCTTTTCTGGAGCTGG - Intronic
959606871 3:108250584-108250606 TTCTGTTTGTTCTCTGGAACTGG + Intergenic
962014776 3:131428579-131428601 ACTTGTTTTTTCTCTTTAACTGG + Intergenic
962451534 3:135522035-135522057 GCTTATTTCAGCTCTGAAACAGG - Intergenic
963245194 3:143051817-143051839 GCCTGCTTTTTCTCTGAAACTGG + Intronic
963726987 3:148934019-148934041 GTTTGTTTGTTTTCTGGATCAGG + Intergenic
966417045 3:179700151-179700173 GCTTGGTTCATCTCTGGTAAAGG - Intronic
969924306 4:10571755-10571777 GCTTGTTCATCCTCTGGTACTGG + Exonic
970809407 4:20074055-20074077 GCGTCTTACTTCTCTGAAACAGG - Intergenic
971920580 4:32934068-32934090 GTTTGTTTCTTTTTTGGAACAGG - Intergenic
973260984 4:48162988-48163010 TCTTGTTTCTTATCTTAAACTGG - Intronic
974383058 4:61167281-61167303 GCTTCTTTCTTCTGTTGAAATGG + Intergenic
976018603 4:80591500-80591522 GATTATTTCTTCTCTGGAAATGG + Intronic
978566878 4:110092160-110092182 TCTTGTTTCTTCCTTGAAACCGG - Intronic
979247109 4:118520028-118520050 GCCTGTTTCTTCTCTTTAAATGG + Intergenic
980703323 4:136459029-136459051 GTTGGCTTCTTCTCTGGAATAGG - Intergenic
983550898 4:169016433-169016455 TCCTGTTTCTGCTCTGGAATAGG - Intergenic
984658616 4:182348222-182348244 CCTTGTTTCTTCTTTTGAATTGG - Intronic
986599727 5:9459819-9459841 GATTGTTTATTCAATGGAACTGG + Intronic
988522076 5:31955147-31955169 TCTTCTTTCTTTTTTGGAACAGG + Intronic
989106444 5:37867507-37867529 GCATGTTTCATTTCTGGAGCTGG - Intergenic
991123676 5:63045489-63045511 CTTTGTTTCTTCTGTGGAATAGG + Intergenic
991647772 5:68818531-68818553 GCTTCTCTCTCCTCTGGCACTGG - Intergenic
995240729 5:109883187-109883209 TCTTGTTTTTTCTCTGGTCCAGG - Exonic
995485373 5:112635182-112635204 TCTTGATTCTTCACTGGCACGGG - Intergenic
995837879 5:116416187-116416209 TCCTTTTTATTCTCTGGAACTGG + Intergenic
996577623 5:124993681-124993703 GCTGGTGTCCTCTCTGGAGCAGG + Intergenic
997477186 5:134150400-134150422 CCTTTCTTCCTCTCTGGAACAGG - Exonic
1000633511 5:163617440-163617462 GCTTGGTGCATCTCTAGAACAGG - Intergenic
1003038148 6:2662658-2662680 GCCTGTTTCTTGTCTGGAGACGG - Intergenic
1003515797 6:6817757-6817779 GATTGTATCTTCTCTGCATCAGG + Intergenic
1004083191 6:12416520-12416542 TCTTCTCTCTTCTCTGGAAGGGG + Intergenic
1005066082 6:21819116-21819138 CCTTCTTTCTTCTTTGAAACAGG - Intergenic
1006534319 6:34685821-34685843 TCATGTTTCTGCTCTGGGACTGG - Intronic
1008442909 6:51553618-51553640 GCTTGTCTCTCCTCTGCTACAGG + Intergenic
1009871970 6:69464350-69464372 TCTTGTTGCTTTTCTGAAACCGG - Intergenic
1010044434 6:71424708-71424730 TCTTCTTGCTTCTCTGGAAAAGG - Intergenic
1011700672 6:89951492-89951514 GCTTCTTCCTTCTCTGCTACGGG + Exonic
1012096667 6:94971206-94971228 GCTTCTTTATTGTCTGGCACTGG + Intergenic
1012910000 6:105107470-105107492 GTTTGTTCATCCTCTGGAACAGG - Intronic
1013736701 6:113235636-113235658 GCTTATTTCTACTCTAGAACTGG - Intergenic
1013845115 6:114441046-114441068 ACTTATCTCTTCTCTGCAACAGG + Intergenic
1014341521 6:120213555-120213577 GCTTGTTCCATCTTTGGAAAGGG + Intergenic
1016312468 6:142748678-142748700 GCTTATTTCTGCCCTGGAAATGG - Intergenic
1016573349 6:145539673-145539695 TCTTGTTTCTTCTTTGGACTGGG - Intronic
1020804601 7:12772879-12772901 GCTAGCTTCTTTACTGGAACTGG + Intergenic
1023615154 7:42012244-42012266 GCTTGTCGATTCTCTGTAACAGG - Intronic
1025084877 7:56015318-56015340 GCTTGTTTATTCCCAGGAACAGG - Intronic
1028443509 7:90892054-90892076 ACTTGTTTCTGCCCTGGAAATGG + Intronic
1028541126 7:91943191-91943213 GTTTGTTTGTTTTCTGAAACAGG - Intronic
1030968020 7:116017766-116017788 GCTTCTCTCTTTTCAGGAACAGG + Intronic
1031592122 7:123606116-123606138 GCTTTTTTATTGTCTGTAACTGG + Intronic
1031882691 7:127215042-127215064 GCTTGTTTACTCTGTGTAACTGG + Intronic
1032759531 7:134926800-134926822 GCATGGTACTTCTCTAGAACAGG - Intronic
1033509667 7:142047076-142047098 TCTTGTTTCTCCTCTGTCACTGG - Intronic
1033607825 7:142940342-142940364 TCTTGATTCTGGTCTGGAACAGG - Exonic
1033994900 7:147333204-147333226 CCTTCTGTTTTCTCTGGAACAGG - Intronic
1035554659 8:557486-557508 CCCTGTCTCTTTTCTGGAACTGG + Intergenic
1036633100 8:10529207-10529229 GCTTGTTTCTGCTCTCGTCCAGG - Intronic
1037438033 8:18884977-18884999 TAGTGTTTCTTCTCTGTAACAGG - Intronic
1038400355 8:27279816-27279838 GCTTCTGTCTTCCCTGGTACTGG + Intergenic
1038615326 8:29088734-29088756 GTGTGTTTCTTCTCTGAAAAAGG - Intronic
1039020535 8:33200015-33200037 GCATGTTTGTTCTCTGGGTCAGG + Intergenic
1039422190 8:37452474-37452496 TCTTATTACTCCTCTGGAACAGG + Intergenic
1039785115 8:40827809-40827831 GCTTCTGCCCTCTCTGGAACAGG - Intronic
1039839067 8:41280660-41280682 GTTTGTTTCTTCTCAAGAAATGG - Intronic
1039974652 8:42351902-42351924 GTTTTTCTCTTCTCTTGAACAGG + Intronic
1041474621 8:58249469-58249491 GCCTGTTCCTTCTCCGGAGCAGG - Intergenic
1043111286 8:76186192-76186214 GTTTGTTGCTTCTTTGTAACTGG - Intergenic
1044031097 8:87238447-87238469 GCCTGTTTATTCTCTGTAACAGG + Intronic
1047684950 8:127295438-127295460 TCTGGTTTCTTCTCTTGGACCGG + Intergenic
1051977334 9:22966820-22966842 GCTTGTTTGTTCTCTGTCAGTGG + Intergenic
1052038192 9:23707034-23707056 CCTTGTTTCTTCTGTAGAACAGG - Intronic
1057028911 9:91758552-91758574 GCTTCTGTCTGCTCTGGACCTGG - Intronic
1058610999 9:106775384-106775406 AAGTGTTTCTTCTCTGGAGCTGG + Intergenic
1059238487 9:112782974-112782996 GGTTGGATCTTCTCTGGAGCTGG + Intronic
1060490401 9:124079958-124079980 GTCTGTTTCTTCTCTGAAATGGG + Intergenic
1061513673 9:131076190-131076212 TCTTGTCTCTTCTCTTGAAGAGG - Intronic
1061540211 9:131274274-131274296 CCTAGTTTCTTCCCTGGAAGGGG - Intronic
1186118909 X:6337164-6337186 TCTTCTTTCTTCTCTTAAACAGG + Intergenic
1186189077 X:7051699-7051721 GCTTGTTTATACTATGGAGCAGG - Intronic
1186585380 X:10867578-10867600 GCTTGTTTCTTCTCTGGATGTGG - Intergenic
1188486199 X:30685007-30685029 CCTTTTATCTTTTCTGGAACTGG + Intronic
1188841027 X:35017572-35017594 GCTTTTTTCCTCTCTTGCACTGG + Intergenic
1189751188 X:44224762-44224784 GCTTGTCTCTTCTCTCCACCTGG - Intronic
1190284754 X:48954715-48954737 GCTTTTTTCTTCCCAGGGACAGG - Intronic
1192070540 X:67935987-67936009 GCTTTTTCCTTCTCTGTGACAGG + Intergenic
1192328350 X:70152886-70152908 CCTTCTTTCTCCTCTGGTACTGG - Intronic
1192493302 X:71595393-71595415 GCTTGTTTCTTCTTTTTAAGTGG + Intronic
1193027466 X:76859922-76859944 GCTTATTTCTCATCTGAAACTGG + Intergenic
1195024354 X:100861342-100861364 GCTTAGTTCTCATCTGGAACAGG - Intronic
1195292730 X:103444656-103444678 CTGTGTTTCTTCCCTGGAACAGG + Intergenic
1195528933 X:105929792-105929814 GCTTTTTGCTTATCTGGAAGAGG + Intronic
1198739877 X:139830765-139830787 GCTATTTTCTTCTCTGAAGCAGG + Intronic