ID: 1179373809

View in Genome Browser
Species Human (GRCh38)
Location 21:40830928-40830950
Sequence CTCCATGGGATCCCTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179373805_1179373809 24 Left 1179373805 21:40830881-40830903 CCACAGACAAGAAGACAAATATC 0: 1
1: 0
2: 3
3: 54
4: 656
Right 1179373809 21:40830928-40830950 CTCCATGGGATCCCTGGCCAAGG 0: 1
1: 0
2: 1
3: 33
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179373809 Original CRISPR CTCCATGGGATCCCTGGCCA AGG Intronic
900477162 1:2881451-2881473 CTCCATGGGCTCTGGGGCCAGGG + Intergenic
901060255 1:6468552-6468574 CTCCACGGAGACCCTGGCCATGG - Exonic
901522938 1:9799262-9799284 CTCCATGGGAACCGGTGCCAGGG + Intronic
901744431 1:11363134-11363156 CTCTAGTGGATCCCTGGCCAAGG - Intergenic
902043612 1:13509870-13509892 CTCCAGGGGATTCCTGTGCATGG - Intronic
902439325 1:16419124-16419146 CTCCTTGAGATGGCTGGCCAGGG + Intronic
903472675 1:23598448-23598470 CTCCATGGGGTGCCAGGCCCAGG - Intronic
905274204 1:36806551-36806573 CTTCCTGGAAACCCTGGCCATGG + Intronic
907635007 1:56125395-56125417 CTCCCTGGGGTCCTTGGCCTGGG - Intergenic
910806562 1:91194250-91194272 CTCCAGGGAATCCCTAGCCCAGG + Intergenic
919753615 1:201053363-201053385 CCCCAGGGGAGCCCTGGGCAAGG - Intronic
920683463 1:208090853-208090875 CACCATGGGAGGCCTGGGCAGGG - Intronic
921960693 1:221030772-221030794 ATCCATTGCACCCCTGGCCAAGG + Intergenic
922722098 1:227904435-227904457 CTCCATGGGATCCCGGGTGGCGG + Intergenic
922798991 1:228355569-228355591 CCCCAGGGGATGCCTGGGCAGGG - Intronic
922988621 1:229886246-229886268 CTCCACTGGATATCTGGCCATGG - Intergenic
923052612 1:230399392-230399414 CTCCAGGGCATCCCTGGCCTGGG - Intronic
924148037 1:241097562-241097584 CTTCATGGGATTCCTGTACAGGG - Intronic
1063105556 10:2988673-2988695 CTCCATGGGGCCGCTGGACAGGG + Intergenic
1064307977 10:14185841-14185863 CTCTATGGGAAACCTGGCCATGG - Intronic
1066041677 10:31554448-31554470 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1070595609 10:77830777-77830799 CTCCATGGAATCCGTGTCAATGG + Exonic
1073121557 10:101125220-101125242 CTCAAAGGGCTCCCTGGGCACGG - Intronic
1074831745 10:117254466-117254488 CGCCTTGGGAGGCCTGGCCATGG + Exonic
1075556213 10:123434448-123434470 CCCCATCAGATCCCTGGCCCAGG - Intergenic
1075559106 10:123455752-123455774 CACATTGGGTTCCCTGGCCATGG + Intergenic
1077014474 11:393622-393644 CTCCATGGAGGCCCTGGCCCTGG - Intronic
1077122693 11:917592-917614 CCCGAGGGGCTCCCTGGCCAGGG - Intergenic
1077412132 11:2408580-2408602 CTCCAGGGTGTCCCTGCCCAGGG - Intronic
1077431675 11:2518753-2518775 AGCCATGGGATCCCAGCCCAAGG - Intronic
1077919872 11:6633852-6633874 GCCCATGGGATCCCTGGTCAGGG + Exonic
1078051963 11:7973547-7973569 CCCCATGTCATACCTGGCCATGG - Intronic
1079012555 11:16841352-16841374 CTCCCTGGGATCCACAGCCATGG - Intronic
1080867880 11:36211657-36211679 CTGCCTGGGGTCCCTGGCCCAGG + Intronic
1081934092 11:46892975-46892997 CTCCATGGGATGCAAGGCAATGG + Exonic
1083503911 11:63137487-63137509 CACAATGGGATCTCTGGGCAAGG - Intronic
1084416410 11:69035415-69035437 CTCCCGGTGGTCCCTGGCCATGG - Intergenic
1084423614 11:69072561-69072583 CTCCCTTGGAACCCTGGCCTGGG - Intronic
1088428907 11:109735675-109735697 CCCCAAGGGATCCATGGCTATGG - Intergenic
1090522436 11:127493692-127493714 CTCCACTGGGTCCCTGGCCTTGG + Intergenic
1091181068 11:133605262-133605284 CTCCAGTGGGTCCCTGGTCAAGG - Intergenic
1091222414 11:133937144-133937166 CGCCATGTGGTGCCTGGCCACGG + Intronic
1091353185 11:134913966-134913988 CTCCCTGGAATCCCTGACAATGG - Intergenic
1092258298 12:6938841-6938863 CTACATGGGGTCCCTGGGCCGGG + Exonic
1093786142 12:23193956-23193978 ATCCATTGGAACTCTGGCCAAGG + Intergenic
1094386161 12:29896005-29896027 TTCCATGGGTTCCCTGCCCAGGG - Intergenic
1094672099 12:32580237-32580259 CTCTATGGGATCCCTGTCTTTGG + Intronic
1096958090 12:55547197-55547219 CTTCATGGGTTCACTGCCCAGGG - Intergenic
1097162662 12:57059692-57059714 CTCTATGGGATCCCTGAGGAAGG - Exonic
1100745136 12:97637298-97637320 ATGCATGGGATCCCTGGAGAAGG + Intergenic
1101210882 12:102534280-102534302 CTCCATGGAAAACCTGGCCCTGG + Intergenic
1101771769 12:107758757-107758779 TTTTATGGGATCCATGGCCAGGG - Intronic
1101997327 12:109534507-109534529 CTCCCTGGGCTCCCTGGCCTTGG + Intronic
1102215785 12:111160628-111160650 CTCCATTGGCTCCCTGGACATGG - Intronic
1102345704 12:112159789-112159811 CAACCTGGGCTCCCTGGCCAGGG + Intergenic
1104590689 12:130082226-130082248 CTCCATGGCAGCCCTGCCCTGGG + Intergenic
1104974989 12:132548305-132548327 CCCCATGGCAGCCCTGCCCAGGG - Intronic
1110056918 13:70985447-70985469 CTCCATGAGGTCCCTGCCCATGG + Intergenic
1112652253 13:101412521-101412543 CTCCATGAGATCCCAGGGCAAGG - Intronic
1114531745 14:23400828-23400850 CTCCATCGGGGCTCTGGCCAAGG - Exonic
1115826338 14:37282394-37282416 CCACATTGGATCCCTGCCCAAGG + Intronic
1116320293 14:43454170-43454192 CTCCCTGGGATCCCTGGCAAAGG + Intergenic
1116657873 14:47674525-47674547 CTGGAGGGGATCTCTGGCCAAGG - Exonic
1117736972 14:58777539-58777561 AGCCATGGGAACCCTGGGCAGGG - Intergenic
1119145846 14:72313378-72313400 CACTATGGGATCAGTGGCCAGGG - Intronic
1121010736 14:90518670-90518692 CTCCATGTGATGCCTGGGGAAGG + Intergenic
1121885656 14:97540402-97540424 CTCCAGGGCATCACTGACCAAGG + Intergenic
1122009756 14:98736441-98736463 GTCCATGGCAGCCCAGGCCAGGG + Intergenic
1122425392 14:101602535-101602557 CTCCATGGGGCCCCTCCCCAGGG - Intergenic
1122786516 14:104166653-104166675 CTCCATGGCGTCCCTGCCCCAGG - Intronic
1122969331 14:105146119-105146141 CTCCCTGGGAGCCCTGGGTAGGG - Intronic
1124460448 15:29885348-29885370 CTCCATGTGTTCCCTTGCCAGGG - Intronic
1126775886 15:52100359-52100381 CTCCAGGAGAGCCGTGGCCAGGG + Intergenic
1127007243 15:54584122-54584144 CTCCAGGAGAGCCCTGGCCAAGG - Intronic
1129615952 15:77098830-77098852 CTCCATGGCAGCCCTGGCAGGGG + Intergenic
1130998846 15:88921889-88921911 CACAATGGGATCTCTGGGCAAGG - Intergenic
1132282134 15:100628580-100628602 CCCCATGGCATCCCTGGCTGGGG - Intronic
1132594788 16:743833-743855 CTCCCTGGGTTCCCTGGCCCTGG - Intronic
1133207053 16:4240113-4240135 CTCTGTGGGGTCCCTGGCCTAGG + Intronic
1133240681 16:4412484-4412506 ATCTCTGGGATCCCTGGGCAAGG - Intronic
1134254926 16:12602963-12602985 CTACATGGGAGCCCTGGGCTGGG - Intergenic
1135158749 16:20075035-20075057 CTCCTGGGGATGCCTGGCCTGGG - Intergenic
1138474685 16:57263782-57263804 CTCTCTGGAATCCCTGGCCACGG + Intronic
1140063429 16:71590336-71590358 CTATTTGGGATCCCTGGCCTTGG + Intergenic
1141324061 16:83039103-83039125 CTCCGTGGGAACCTGGGCCATGG - Intronic
1141988580 16:87595993-87596015 CTCCAGGGGATCCCTGGAGAGGG + Intergenic
1143251781 17:5528200-5528222 TACCTGGGGATCCCTGGCCACGG + Intronic
1143265329 17:5632555-5632577 CTCCATGGAAACCCTTGTCAAGG + Intergenic
1143346161 17:6250709-6250731 CTCCGTGGGTTCTCTGTCCATGG - Intergenic
1143450292 17:7032289-7032311 CTCCATGGGCTCACCGCCCAGGG - Intergenic
1143904935 17:10200377-10200399 CTCCATCTGTTCTCTGGCCATGG + Intergenic
1143916216 17:10295236-10295258 ATCAATGGGATCCCTTGCCCTGG - Intergenic
1144093731 17:11881334-11881356 CTCCAGGCCATCCCTGGTCACGG - Exonic
1144195470 17:12890502-12890524 TTCCATGGGTTCACTGCCCAAGG - Intronic
1145259643 17:21347108-21347130 CTCCAGGGGAGTCCAGGCCAGGG - Intergenic
1145316972 17:21740840-21740862 CTCCAGGGGAGCCCAGGCCAGGG + Intergenic
1146378966 17:32314582-32314604 CTCCCTGGGAGCCCTGGGAAGGG - Intronic
1146621789 17:34404447-34404469 CTCCATGGCCTCCATGGGCACGG + Intergenic
1146903979 17:36606390-36606412 ATCCATCAGAGCCCTGGCCAAGG - Intronic
1148441510 17:47713909-47713931 CTGCATGGGGACCCAGGCCAGGG - Intergenic
1148874631 17:50679684-50679706 ATCCATGGGATCCTAGCCCATGG - Intronic
1150234716 17:63583689-63583711 CTCCATTCCATCCATGGCCATGG - Exonic
1152123372 17:78432440-78432462 CTCCCTGTGCTCCCTGGCAATGG - Intronic
1152244795 17:79179723-79179745 GTCCACTGGATCCCAGGCCAGGG + Intronic
1152626037 17:81388407-81388429 CCCCATGGGAGCCATGGCCAAGG + Intergenic
1154205648 18:12334571-12334593 CTCCAAGGCATCCCTGGGCAGGG - Intronic
1155502959 18:26505173-26505195 ATGCTTGGCATCCCTGGCCAAGG - Intronic
1157316678 18:46595936-46595958 CCCCATGGGTTCCCTGAACATGG + Intronic
1157327112 18:46677323-46677345 CTCCATTGGGTGCCTGACCAAGG + Intronic
1159709964 18:71745703-71745725 CTCCATGTGGTCCCTTCCCATGG - Intronic
1163382544 19:16978416-16978438 CTCCCTGGAATCCTTGTCCAGGG - Intronic
1163499061 19:17664717-17664739 TTCCTTGGCTTCCCTGGCCAGGG - Intronic
1163645242 19:18485522-18485544 CTCCCTGGTCTCCCTGGCCCTGG - Intronic
1163846302 19:19640120-19640142 CAGCCTGGGAACCCTGGCCATGG - Exonic
1164670741 19:30070685-30070707 CTCCCAGGGAGCCCTGTCCAGGG + Intergenic
1165040179 19:33063550-33063572 CTCTCAGTGATCCCTGGCCAAGG + Intronic
1165062648 19:33212371-33212393 CTCCGTGGGACACCTGGCCCTGG - Exonic
1165810314 19:38607972-38607994 CTCCCTGGGGTCCCTGACCTGGG + Exonic
1165823500 19:38692503-38692525 CTCCACGGGCCCCCTTGCCAGGG + Intronic
1166713554 19:44952194-44952216 CTCCACAGGAGCCCTGTCCAAGG + Intronic
1167156642 19:47742957-47742979 TTCCATGGGGTCCCCTGCCAGGG - Exonic
1167445488 19:49534803-49534825 GTACTTGAGATCCCTGGCCAAGG + Intronic
1167721488 19:51183036-51183058 CTCCATGGACTCTCTTGCCAGGG + Intergenic
1167763489 19:51463734-51463756 CTCCATGGACTCTCTTGCCAGGG - Intergenic
925349372 2:3190144-3190166 CTCACTGGGAGCCCTGACCAGGG + Intronic
925905588 2:8537993-8538015 CTCCCTGGGAGCCCAGGCCCTGG - Intergenic
926134378 2:10326268-10326290 CCTCAAGGGGTCCCTGGCCAAGG + Intronic
927839494 2:26430411-26430433 CTTCATGGGATCCCCAACCATGG + Intronic
929664428 2:43822754-43822776 CTCCATGGGAGCCCGGCCCTGGG + Intronic
929815069 2:45223863-45223885 CTCCATGGGATGCCAGGCCCTGG + Intergenic
932457801 2:71860728-71860750 TTCCATGGGATCACAGACCAGGG + Intergenic
932471275 2:71961048-71961070 CTCCAAGGGAACCAGGGCCAGGG - Intergenic
935144099 2:100382406-100382428 TTCCATGGGATACCTAGGCATGG - Intergenic
940124485 2:150309292-150309314 AACCCTGGGATCCCTGGCAAGGG + Intergenic
943755283 2:191550766-191550788 CACCATGTGATCCAAGGCCAAGG - Intergenic
944379614 2:199092688-199092710 CTCCATGGGCTCACTGCCCAGGG - Intergenic
946192982 2:218017173-218017195 TTCCATGAGATCCTTGGCCAGGG - Intergenic
947139956 2:227011547-227011569 CTCCAGAGAGTCCCTGGCCAGGG - Intronic
947731475 2:232433798-232433820 CCCCATGGGCTGCCCGGCCATGG + Intergenic
948290298 2:236819416-236819438 CTCCATGTGAGCACTGACCATGG - Intergenic
948673682 2:239584632-239584654 CTCCATGAGATGCCTGGGCGGGG - Exonic
948832282 2:240603940-240603962 CCCCATGGCATCCCTGGACAAGG + Intronic
949042255 2:241854754-241854776 CTGCATGGCAGCCCTGGCCTGGG - Intronic
1168931391 20:1627167-1627189 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1169197724 20:3692485-3692507 CTCCTGGGCAGCCCTGGCCAAGG + Intronic
1169660841 20:7976554-7976576 CTGCCTGGGATGCCTGGCCTGGG + Intergenic
1170799358 20:19578230-19578252 CACCATGTGACCCCTGGCCCCGG - Intronic
1171372503 20:24670646-24670668 CACCCTGGGAGCCCTGGGCACGG - Intergenic
1171805530 20:29676000-29676022 CTACACAGGAACCCTGGCCATGG - Intergenic
1171838527 20:30180416-30180438 CTACGTAGGAACCCTGGCCATGG + Intergenic
1172165141 20:32894252-32894274 CTCCAGGGGTTCCCAGGCCTTGG + Intronic
1172188017 20:33043519-33043541 TTCTATGGAATCCCTGGTCAAGG - Intronic
1173392319 20:42646203-42646225 CTCCAGGGGACCCACGGCCAAGG + Intronic
1174107429 20:48172531-48172553 CTCCCAGGGATCCCTGGAAATGG + Intergenic
1175263251 20:57687907-57687929 GTCTATGGGTTCCCTGTCCAGGG + Intronic
1175692458 20:61075456-61075478 GTCCAAAGGATGCCTGGCCAGGG - Intergenic
1175929306 20:62486078-62486100 CACCATGGGCGCCCTGGCTAGGG + Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176110896 20:63410270-63410292 CCCAATAGGAGCCCTGGCCACGG + Intronic
1176121981 20:63458123-63458145 GTCCAGGGGACCCCAGGCCAGGG - Intronic
1178700287 21:34827630-34827652 CTTCATGGGCTCACTGCCCAGGG + Intronic
1179340215 21:40500855-40500877 CTCAATGGGCTCCCAGGTCATGG - Intronic
1179373809 21:40830928-40830950 CTCCATGGGATCCCTGGCCAAGG + Intronic
1180050643 21:45329564-45329586 CTCCCTGGGCTCCGTGGCCCCGG + Intergenic
1181596497 22:23918356-23918378 CTCCCAGAGATCACTGGCCAAGG - Intergenic
1181681646 22:24499620-24499642 ATCCATGTGATCCCAGGTCATGG + Intronic
1183030231 22:35098291-35098313 CTGCATGGGGTTCCTGTCCATGG + Intergenic
1183084358 22:35477473-35477495 CTCCATGGGATGCCTGGAGTTGG - Intergenic
1183785729 22:40028127-40028149 CCCCAAGGGCTCCATGGCCAAGG - Intronic
1184112110 22:42401534-42401556 CTCCACGGGACCCCTTGCCCCGG - Intronic
1184580573 22:45413883-45413905 TTCCATGGGTTCCCAGACCATGG + Exonic
1184699003 22:46156975-46156997 CTCCATGGCATACCTGGACCAGG + Intronic
1184962907 22:47944508-47944530 CTCCATGGGAGCTCTGGCAGTGG - Intergenic
1185244781 22:49767605-49767627 GTCCATAGGTTCCCTGGGCATGG - Intergenic
951183188 3:19682583-19682605 CTTGCTGGGATCCCTGGGCATGG + Intergenic
951522987 3:23626568-23626590 CTCCATGGGCTTCCTGCCTAGGG - Intergenic
952848260 3:37706644-37706666 CTCAATGACACCCCTGGCCAGGG - Intronic
954131371 3:48562834-48562856 CTCCCTGGCAGCCCTGGCCCGGG + Exonic
954133674 3:48572409-48572431 CTCCAGGGGCTCCCTGGTAAGGG + Exonic
954510601 3:51121442-51121464 TTCCCTGGGATTCCTGGGCAAGG - Intronic
954792689 3:53144736-53144758 CTCAAGGGGATTCCTGCCCAAGG - Intergenic
960087423 3:113606144-113606166 CTCCATAGAATCCTAGGCCAAGG + Intronic
961412529 3:126733156-126733178 CTCCAAGGCATCCCTGCCCACGG + Exonic
962935495 3:140076823-140076845 CTTCATGGCATCCTTGGTCAAGG - Intronic
963517533 3:146326847-146326869 CTCCATGGCATCACTGGCTAGGG + Intergenic
968595110 4:1478166-1478188 ATCCAAGGGCTCCCTGGCCCTGG + Intergenic
969097335 4:4743558-4743580 CCCCATGGGCTCCATGGCTATGG - Intergenic
969212778 4:5700586-5700608 CTCCATGAGAACCCTGGGCCAGG + Intronic
969471134 4:7389928-7389950 CTCCTGGGGATGCCTTGCCAGGG + Intronic
972733706 4:41819463-41819485 CTCCATGGGTCCCCTGGCCCAGG - Intergenic
973550758 4:52033997-52034019 ATCCATGGGATCCATATCCATGG + Intronic
975240122 4:72047395-72047417 CTCCATGGGCTCACTGCCCAGGG + Intronic
977130255 4:93227016-93227038 CATCATGGGCTCCCTGTCCAGGG - Intronic
981819383 4:148868274-148868296 CACCATGGAAACCGTGGCCATGG - Intergenic
982031291 4:151303701-151303723 ATCCAAGGGATATCTGGCCAGGG - Intronic
985135023 4:186777895-186777917 CCCCATGTGCTCCCTGGGCAGGG + Intergenic
985635068 5:1031841-1031863 CAGCATGGGGGCCCTGGCCAAGG + Intronic
985642266 5:1069248-1069270 CTCCATGGGATCCTGGCCCTAGG + Intronic
985747234 5:1654340-1654362 GTCCAAGGGCTCCATGGCCAGGG - Intergenic
985765673 5:1778202-1778224 CTCCCTGGGAACACTGGCAAAGG + Intergenic
985888232 5:2696649-2696671 CTACATGGCTGCCCTGGCCATGG + Intergenic
986124805 5:4875065-4875087 CTCCATGGGAGAACTGGCCAAGG + Intergenic
986223582 5:5792526-5792548 CTCCATGGGATCCTTGGATTCGG + Intergenic
986985870 5:13500587-13500609 CTCCATGGACTCACTGCCCAGGG + Intergenic
988316407 5:29635232-29635254 CTACATGGGAAAACTGGCCAGGG - Intergenic
989993269 5:50795017-50795039 CGCCCTGGGATCGCTGGACAAGG - Exonic
991585290 5:68196007-68196029 CTCTATGGGATCACTGGGCCAGG - Intronic
992084457 5:73265502-73265524 TTCAATGGTATCCCTGGGCAAGG + Intergenic
993382053 5:87219327-87219349 CACAATGAGATCCCTGGACATGG - Intergenic
995394451 5:111672698-111672720 CCCCAGGGGATCCCTGGCAGTGG - Intronic
995654509 5:114410107-114410129 GTTCATGGGGTCCCAGGCCAAGG + Intronic
996234261 5:121107465-121107487 CTCCATGGGCTCCCTGGCTCCGG + Intergenic
997184674 5:131869807-131869829 CTCCATGGGAACCATTGCCAGGG - Intronic
1003684849 6:8292289-8292311 CTCCATGTGGACCCTGGCCATGG - Intergenic
1004422878 6:15487458-15487480 CTCCACGGGTTCCTCGGCCAAGG + Exonic
1007582202 6:42966296-42966318 CTCCATGGGCCCCCTGGCACCGG - Exonic
1010054680 6:71551566-71551588 CTCCATGGGTTCCCATGTCAGGG + Intergenic
1010302184 6:74273896-74273918 CTCCATGAGATCACTGCCCAGGG - Intergenic
1013484855 6:110587114-110587136 GTGCATGGGAGCCCTGGCTAAGG + Intergenic
1017947192 6:159105174-159105196 CTTCATGGGCTCCCTGGCAGCGG + Intergenic
1018043421 6:159945142-159945164 GTCCATGGGTTCACTGGCCAGGG + Intergenic
1018898589 6:168038828-168038850 CTCCTTGGGATCCTTGGGCGTGG - Intronic
1019596014 7:1858757-1858779 CACCATGGGGTCCCAGGGCAAGG + Intronic
1021411830 7:20337790-20337812 CCCCATGGACTCCCTGCCCATGG - Intronic
1022122459 7:27322713-27322735 GTCCATGGGTTCTGTGGCCAAGG + Intergenic
1023412650 7:39903046-39903068 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1026143245 7:67723914-67723936 CTCCATGGGACCTCTGGCATGGG + Intergenic
1027627716 7:80565204-80565226 CTCCCTGGGATCTCTGTCCCAGG + Intronic
1029403069 7:100357321-100357343 CTGCATGGGAGCCCCTGCCAGGG + Intronic
1029405685 7:100373062-100373084 CTGCATGGGAGCCCCTGCCAGGG + Intronic
1030749125 7:113208134-113208156 ATCCATGGGATCACATGCCATGG - Intergenic
1033471591 7:141654782-141654804 CTCCATGGGATGTGTGGGCATGG - Exonic
1034020598 7:147637619-147637641 CTCCATGAAATCCCTGCCCGTGG - Intronic
1036049373 8:5179093-5179115 CTCCCTGGGCTCACTGCCCAGGG + Intergenic
1036679520 8:10860856-10860878 CTCCGTGATATGCCTGGCCATGG - Intergenic
1038720258 8:30028581-30028603 CTCCCTGGGGTCCTTGGCCTGGG - Intergenic
1038940030 8:32294119-32294141 CTCCGTAGGATGCCTGTCCACGG + Intronic
1039131989 8:34275593-34275615 CTCCTTGGGAACCAGGGCCAGGG + Intergenic
1039289177 8:36075437-36075459 CTGCATTGGGTGCCTGGCCAAGG + Intergenic
1039834755 8:41247648-41247670 CTCCATTGGATCCCTGTCCTGGG - Intergenic
1043495692 8:80797633-80797655 CTCCGTGGGCTTCCTGCCCAGGG - Intronic
1044839217 8:96323603-96323625 CTCCACGGGCTCACTGACCAGGG - Intronic
1046771646 8:118122580-118122602 CAACATGGGACCCCTGGGCAGGG + Intergenic
1046792835 8:118340334-118340356 CTCCATGGGCCCCCTTGGCAAGG - Intronic
1047220109 8:122911979-122912001 CCCCCTGGAATCCCTGGCTAAGG + Intronic
1048860980 8:138724391-138724413 CTCCCTGGGTGCCCTGGCCAGGG - Intronic
1049513591 8:143042280-143042302 CATCATGGGAGCCCTAGCCAGGG + Intronic
1051331708 9:16030803-16030825 CTCCATGTGATCGCTTCCCAAGG + Intronic
1051809227 9:21031409-21031431 CTCCAAGGGGTGCCTGGGCACGG + Intronic
1057007454 9:91573171-91573193 CAGCATGGGATCCCTTCCCATGG - Intronic
1057817945 9:98309499-98309521 CTCCATGGCATCTATGGACAGGG + Intronic
1059311155 9:113389864-113389886 CACCCTGGGATACCTGGCAAGGG - Intronic
1060258269 9:122051829-122051851 CTCCAGGAGAGCCCTGACCAAGG - Intronic
1060264424 9:122102197-122102219 CTCCAGGGCATCCCTGTCCCTGG + Intergenic
1060514776 9:124258663-124258685 CTCCACGGGCTCCCTGGCTCGGG - Intronic
1186618791 X:11215645-11215667 CTCCATGAGCTTCCTGCCCACGG - Intronic
1187412305 X:19062077-19062099 CTCCATCTGACCCCTGGCCTAGG + Intronic
1193668098 X:84349118-84349140 CTCCATGGGAACCATTACCAAGG - Intronic
1197911827 X:131491365-131491387 CTCCATGGGACCCCTGGGTGTGG + Intergenic
1198534491 X:137573733-137573755 CTCCAGTGGATCCTTGGCCGGGG + Intronic
1200142333 X:153908366-153908388 CTCCCTGGGCTCCCTGGGCCTGG + Intronic
1201256693 Y:12114454-12114476 TTCCATGGGCTCACTGCCCATGG + Intergenic