ID: 1179376350

View in Genome Browser
Species Human (GRCh38)
Location 21:40853018-40853040
Sequence CGTGCATTGCAGGATCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179376350_1179376353 23 Left 1179376350 21:40853018-40853040 CCACCTTGATCCTGCAATGCACG No data
Right 1179376353 21:40853064-40853086 ACACACACACACAATATCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179376350 Original CRISPR CGTGCATTGCAGGATCAAGG TGG (reversed) Intergenic
No off target data available for this crispr