ID: 1179376534

View in Genome Browser
Species Human (GRCh38)
Location 21:40854291-40854313
Sequence TGCTGCCCTTGGGGCCACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179376534_1179376540 -2 Left 1179376534 21:40854291-40854313 CCAGCGTGGCCCCAAGGGCAGCA No data
Right 1179376540 21:40854312-40854334 CAGAATGAGGAAGCAGCTCAGGG No data
1179376534_1179376539 -3 Left 1179376534 21:40854291-40854313 CCAGCGTGGCCCCAAGGGCAGCA No data
Right 1179376539 21:40854311-40854333 GCAGAATGAGGAAGCAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179376534 Original CRISPR TGCTGCCCTTGGGGCCACGC TGG (reversed) Intergenic
No off target data available for this crispr