ID: 1179376539

View in Genome Browser
Species Human (GRCh38)
Location 21:40854311-40854333
Sequence GCAGAATGAGGAAGCAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179376534_1179376539 -3 Left 1179376534 21:40854291-40854313 CCAGCGTGGCCCCAAGGGCAGCA No data
Right 1179376539 21:40854311-40854333 GCAGAATGAGGAAGCAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179376539 Original CRISPR GCAGAATGAGGAAGCAGCTC AGG Intergenic
No off target data available for this crispr