ID: 1179382154 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:40909916-40909938 |
| Sequence | AATTATCTACAGCAAATGAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1179382153_1179382154 | 2 | Left | 1179382153 | 21:40909891-40909913 | CCTGGGATATATATAAATACATA | No data | ||
| Right | 1179382154 | 21:40909916-40909938 | AATTATCTACAGCAAATGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1179382154 | Original CRISPR | AATTATCTACAGCAAATGAC AGG | Intergenic | ||
| No off target data available for this crispr | |||||