ID: 1179382154

View in Genome Browser
Species Human (GRCh38)
Location 21:40909916-40909938
Sequence AATTATCTACAGCAAATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179382153_1179382154 2 Left 1179382153 21:40909891-40909913 CCTGGGATATATATAAATACATA No data
Right 1179382154 21:40909916-40909938 AATTATCTACAGCAAATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179382154 Original CRISPR AATTATCTACAGCAAATGAC AGG Intergenic
No off target data available for this crispr