ID: 1179382241

View in Genome Browser
Species Human (GRCh38)
Location 21:40910594-40910616
Sequence ACCACATGTGTCCCTACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179382241_1179382245 13 Left 1179382241 21:40910594-40910616 CCGTGTGTAGGGACACATGTGGT No data
Right 1179382245 21:40910630-40910652 TTATGTAGTGCTACCCACCCAGG No data
1179382241_1179382246 14 Left 1179382241 21:40910594-40910616 CCGTGTGTAGGGACACATGTGGT No data
Right 1179382246 21:40910631-40910653 TATGTAGTGCTACCCACCCAGGG No data
1179382241_1179382247 22 Left 1179382241 21:40910594-40910616 CCGTGTGTAGGGACACATGTGGT No data
Right 1179382247 21:40910639-40910661 GCTACCCACCCAGGGCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179382241 Original CRISPR ACCACATGTGTCCCTACACA CGG (reversed) Intergenic
No off target data available for this crispr