ID: 1179383528

View in Genome Browser
Species Human (GRCh38)
Location 21:40921059-40921081
Sequence GACAGCTCTTGGCCTGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179383526_1179383528 -8 Left 1179383526 21:40921044-40921066 CCATTCTCTTTTTGAGACAGCTC No data
Right 1179383528 21:40921059-40921081 GACAGCTCTTGGCCTGCAACTGG No data
1179383523_1179383528 9 Left 1179383523 21:40921027-40921049 CCATCCTCCACAGATAACCATTC No data
Right 1179383528 21:40921059-40921081 GACAGCTCTTGGCCTGCAACTGG No data
1179383524_1179383528 5 Left 1179383524 21:40921031-40921053 CCTCCACAGATAACCATTCTCTT No data
Right 1179383528 21:40921059-40921081 GACAGCTCTTGGCCTGCAACTGG No data
1179383525_1179383528 2 Left 1179383525 21:40921034-40921056 CCACAGATAACCATTCTCTTTTT No data
Right 1179383528 21:40921059-40921081 GACAGCTCTTGGCCTGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179383528 Original CRISPR GACAGCTCTTGGCCTGCAAC TGG Intergenic
No off target data available for this crispr