ID: 1179385523

View in Genome Browser
Species Human (GRCh38)
Location 21:40938316-40938338
Sequence GTCTGAAGTCAGGGGTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179385514_1179385523 30 Left 1179385514 21:40938263-40938285 CCTTGGTCTTACAACAAGAGCTA No data
Right 1179385523 21:40938316-40938338 GTCTGAAGTCAGGGGTTGGCAGG No data
1179385517_1179385523 0 Left 1179385517 21:40938293-40938315 CCTCACAGTTCTAGAGGCCAGAA No data
Right 1179385523 21:40938316-40938338 GTCTGAAGTCAGGGGTTGGCAGG No data
1179385516_1179385523 1 Left 1179385516 21:40938292-40938314 CCCTCACAGTTCTAGAGGCCAGA No data
Right 1179385523 21:40938316-40938338 GTCTGAAGTCAGGGGTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179385523 Original CRISPR GTCTGAAGTCAGGGGTTGGC AGG Intergenic
No off target data available for this crispr