ID: 1179389629

View in Genome Browser
Species Human (GRCh38)
Location 21:40975861-40975883
Sequence TGCCATGTGGTCTTCTCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179389624_1179389629 7 Left 1179389624 21:40975831-40975853 CCACAGCTCCTAGAGTCACCCAT No data
Right 1179389629 21:40975861-40975883 TGCCATGTGGTCTTCTCTATAGG No data
1179389625_1179389629 -1 Left 1179389625 21:40975839-40975861 CCTAGAGTCACCCATAGTTCTCT No data
Right 1179389629 21:40975861-40975883 TGCCATGTGGTCTTCTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179389629 Original CRISPR TGCCATGTGGTCTTCTCTAT AGG Intergenic
No off target data available for this crispr