ID: 1179390210

View in Genome Browser
Species Human (GRCh38)
Location 21:40981858-40981880
Sequence TAGTAGGACTGGAGGTAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179390210_1179390216 30 Left 1179390210 21:40981858-40981880 CCAATTTACCTCCAGTCCTACTA No data
Right 1179390216 21:40981911-40981933 AAATTACAAGGCATACAGAAAGG No data
1179390210_1179390215 18 Left 1179390210 21:40981858-40981880 CCAATTTACCTCCAGTCCTACTA No data
Right 1179390215 21:40981899-40981921 GCTTTCAACAAAAAATTACAAGG 0: 21
1: 68
2: 144
3: 216
4: 586

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179390210 Original CRISPR TAGTAGGACTGGAGGTAAAT TGG (reversed) Intergenic
No off target data available for this crispr