ID: 1179391026

View in Genome Browser
Species Human (GRCh38)
Location 21:40991006-40991028
Sequence CAAACGGATGTTTCTACAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179391019_1179391026 27 Left 1179391019 21:40990956-40990978 CCTGGTCTCGTGAACGCTTGTCA No data
Right 1179391026 21:40991006-40991028 CAAACGGATGTTTCTACAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179391026 Original CRISPR CAAACGGATGTTTCTACAGG GGG Intergenic
No off target data available for this crispr