ID: 1179394953

View in Genome Browser
Species Human (GRCh38)
Location 21:41030858-41030880
Sequence TGCTCAGTAGAATCCCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179394953_1179394956 1 Left 1179394953 21:41030858-41030880 CCTCCATGGGATTCTACTGAGCA No data
Right 1179394956 21:41030882-41030904 ATAGACAGCTGCAGAGTTGAGGG No data
1179394953_1179394955 0 Left 1179394953 21:41030858-41030880 CCTCCATGGGATTCTACTGAGCA No data
Right 1179394955 21:41030881-41030903 CATAGACAGCTGCAGAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179394953 Original CRISPR TGCTCAGTAGAATCCCATGG AGG (reversed) Intergenic
No off target data available for this crispr