ID: 1179399267

View in Genome Browser
Species Human (GRCh38)
Location 21:41069244-41069266
Sequence GAGTCACGACCTGGTCGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179399264_1179399267 -5 Left 1179399264 21:41069226-41069248 CCCTCTGCTGGCATTGAGGAGTC No data
Right 1179399267 21:41069244-41069266 GAGTCACGACCTGGTCGAACCGG No data
1179399259_1179399267 25 Left 1179399259 21:41069196-41069218 CCCGGAGCTGCAAGGGTCGGTCC No data
Right 1179399267 21:41069244-41069266 GAGTCACGACCTGGTCGAACCGG No data
1179399260_1179399267 24 Left 1179399260 21:41069197-41069219 CCGGAGCTGCAAGGGTCGGTCCG No data
Right 1179399267 21:41069244-41069266 GAGTCACGACCTGGTCGAACCGG No data
1179399262_1179399267 4 Left 1179399262 21:41069217-41069239 CCGCTCGCGCCCTCTGCTGGCAT No data
Right 1179399267 21:41069244-41069266 GAGTCACGACCTGGTCGAACCGG No data
1179399265_1179399267 -6 Left 1179399265 21:41069227-41069249 CCTCTGCTGGCATTGAGGAGTCA No data
Right 1179399267 21:41069244-41069266 GAGTCACGACCTGGTCGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179399267 Original CRISPR GAGTCACGACCTGGTCGAAC CGG Intergenic
No off target data available for this crispr