ID: 1179399306

View in Genome Browser
Species Human (GRCh38)
Location 21:41069500-41069522
Sequence GTAAATTGTAGGGCTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179399300_1179399306 3 Left 1179399300 21:41069474-41069496 CCGTACACTTGAAAATGGTTAAA 0: 5
1: 25
2: 70
3: 132
4: 386
Right 1179399306 21:41069500-41069522 GTAAATTGTAGGGCTGGGCATGG No data
1179399298_1179399306 11 Left 1179399298 21:41069466-41069488 CCACTAAACCGTACACTTGAAAA No data
Right 1179399306 21:41069500-41069522 GTAAATTGTAGGGCTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179399306 Original CRISPR GTAAATTGTAGGGCTGGGCA TGG Intergenic
No off target data available for this crispr