ID: 1179401791

View in Genome Browser
Species Human (GRCh38)
Location 21:41091070-41091092
Sequence CTGTGGTTCATGAGGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179401791_1179401796 -8 Left 1179401791 21:41091070-41091092 CCCGCTTCCCTCATGAACCACAG No data
Right 1179401796 21:41091085-41091107 AACCACAGGAAAGCTTAGCCAGG No data
1179401791_1179401797 -7 Left 1179401791 21:41091070-41091092 CCCGCTTCCCTCATGAACCACAG No data
Right 1179401797 21:41091086-41091108 ACCACAGGAAAGCTTAGCCAGGG No data
1179401791_1179401801 21 Left 1179401791 21:41091070-41091092 CCCGCTTCCCTCATGAACCACAG No data
Right 1179401801 21:41091114-41091136 AAGAGTTGTTAGTGAGTGCCCGG No data
1179401791_1179401802 22 Left 1179401791 21:41091070-41091092 CCCGCTTCCCTCATGAACCACAG No data
Right 1179401802 21:41091115-41091137 AGAGTTGTTAGTGAGTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179401791 Original CRISPR CTGTGGTTCATGAGGGAAGC GGG (reversed) Intergenic
No off target data available for this crispr