ID: 1179403953

View in Genome Browser
Species Human (GRCh38)
Location 21:41110236-41110258
Sequence TTGATGCTATGGCCTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179403953_1179403961 14 Left 1179403953 21:41110236-41110258 CCTCCCACAGGCCATAGCATCAA No data
Right 1179403961 21:41110273-41110295 GTAGGTCGTTCCCTGGGCCCAGG No data
1179403953_1179403960 8 Left 1179403953 21:41110236-41110258 CCTCCCACAGGCCATAGCATCAA No data
Right 1179403960 21:41110267-41110289 GAAAATGTAGGTCGTTCCCTGGG No data
1179403953_1179403959 7 Left 1179403953 21:41110236-41110258 CCTCCCACAGGCCATAGCATCAA No data
Right 1179403959 21:41110266-41110288 TGAAAATGTAGGTCGTTCCCTGG No data
1179403953_1179403958 -4 Left 1179403953 21:41110236-41110258 CCTCCCACAGGCCATAGCATCAA No data
Right 1179403958 21:41110255-41110277 TCAACTCAAGGTGAAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179403953 Original CRISPR TTGATGCTATGGCCTGTGGG AGG (reversed) Intergenic