ID: 1179404100

View in Genome Browser
Species Human (GRCh38)
Location 21:41111200-41111222
Sequence GGGTTTAAGCAGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179404086_1179404100 25 Left 1179404086 21:41111152-41111174 CCCAGGGTACCCTATGAAGATGT No data
Right 1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG No data
1179404087_1179404100 24 Left 1179404087 21:41111153-41111175 CCAGGGTACCCTATGAAGATGTA No data
Right 1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG No data
1179404089_1179404100 15 Left 1179404089 21:41111162-41111184 CCTATGAAGATGTAACGAGAGCG No data
Right 1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG No data
1179404088_1179404100 16 Left 1179404088 21:41111161-41111183 CCCTATGAAGATGTAACGAGAGC No data
Right 1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179404100 Original CRISPR GGGTTTAAGCAGAGGGAGGC AGG Intergenic
No off target data available for this crispr