ID: 1179405731

View in Genome Browser
Species Human (GRCh38)
Location 21:41123998-41124020
Sequence ATGTGCAAATGGATGGACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179405727_1179405731 5 Left 1179405727 21:41123970-41123992 CCTCAGATGCTCAATTTTTGCTG No data
Right 1179405731 21:41123998-41124020 ATGTGCAAATGGATGGACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179405731 Original CRISPR ATGTGCAAATGGATGGACTA GGG Intergenic
No off target data available for this crispr