ID: 1179407570

View in Genome Browser
Species Human (GRCh38)
Location 21:41138056-41138078
Sequence CACCGTTGGAGGGCACTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179407570_1179407576 25 Left 1179407570 21:41138056-41138078 CCACTCAGTGCCCTCCAACGGTG No data
Right 1179407576 21:41138104-41138126 GAGACTGTTGCACCCTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179407570 Original CRISPR CACCGTTGGAGGGCACTGAG TGG (reversed) Intergenic
No off target data available for this crispr