ID: 1179408042

View in Genome Browser
Species Human (GRCh38)
Location 21:41141346-41141368
Sequence CCACAGGCAGAGGCTGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179408039_1179408042 -9 Left 1179408039 21:41141332-41141354 CCAAGAGTGTGGGGCCACAGGCA No data
Right 1179408042 21:41141346-41141368 CCACAGGCAGAGGCTGTGCAAGG No data
1179408032_1179408042 21 Left 1179408032 21:41141302-41141324 CCGGGTGGGGGTTGTTATCTGCA No data
Right 1179408042 21:41141346-41141368 CCACAGGCAGAGGCTGTGCAAGG No data
1179408031_1179408042 22 Left 1179408031 21:41141301-41141323 CCCGGGTGGGGGTTGTTATCTGC No data
Right 1179408042 21:41141346-41141368 CCACAGGCAGAGGCTGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179408042 Original CRISPR CCACAGGCAGAGGCTGTGCA AGG Intergenic
No off target data available for this crispr