ID: 1179409465

View in Genome Browser
Species Human (GRCh38)
Location 21:41151209-41151231
Sequence ATGTGACAGCTGCAGCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179409465_1179409466 -7 Left 1179409465 21:41151209-41151231 CCTAACTGCTGCAGCTGTCACAT No data
Right 1179409466 21:41151225-41151247 GTCACATCTGCTACCCAGAAAGG No data
1179409465_1179409467 -6 Left 1179409465 21:41151209-41151231 CCTAACTGCTGCAGCTGTCACAT No data
Right 1179409467 21:41151226-41151248 TCACATCTGCTACCCAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179409465 Original CRISPR ATGTGACAGCTGCAGCAGTT AGG (reversed) Intergenic
No off target data available for this crispr