ID: 1179409803

View in Genome Browser
Species Human (GRCh38)
Location 21:41153901-41153923
Sequence CTACCTGGAAGGCTACCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179409803_1179409811 6 Left 1179409803 21:41153901-41153923 CCAGCAGGTAGCCTTCCAGGTAG No data
Right 1179409811 21:41153930-41153952 GGGGCTGCAAGGAGGCCTTAAGG No data
1179409803_1179409809 -5 Left 1179409803 21:41153901-41153923 CCAGCAGGTAGCCTTCCAGGTAG No data
Right 1179409809 21:41153919-41153941 GGTAGAAGTAAGGGGCTGCAAGG No data
1179409803_1179409810 -2 Left 1179409803 21:41153901-41153923 CCAGCAGGTAGCCTTCCAGGTAG No data
Right 1179409810 21:41153922-41153944 AGAAGTAAGGGGCTGCAAGGAGG No data
1179409803_1179409812 7 Left 1179409803 21:41153901-41153923 CCAGCAGGTAGCCTTCCAGGTAG No data
Right 1179409812 21:41153931-41153953 GGGCTGCAAGGAGGCCTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179409803 Original CRISPR CTACCTGGAAGGCTACCTGC TGG (reversed) Intergenic
No off target data available for this crispr