ID: 1179410943

View in Genome Browser
Species Human (GRCh38)
Location 21:41162774-41162796
Sequence CTTTGGGACCAGAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179410943_1179410950 3 Left 1179410943 21:41162774-41162796 CCTACTTCCCTCTGGTCCCAAAG No data
Right 1179410950 21:41162800-41162822 CCTAATTAGTCATTTGAAGAAGG No data
1179410943_1179410952 12 Left 1179410943 21:41162774-41162796 CCTACTTCCCTCTGGTCCCAAAG No data
Right 1179410952 21:41162809-41162831 TCATTTGAAGAAGGCGACATGGG No data
1179410943_1179410953 17 Left 1179410943 21:41162774-41162796 CCTACTTCCCTCTGGTCCCAAAG No data
Right 1179410953 21:41162814-41162836 TGAAGAAGGCGACATGGGTTAGG No data
1179410943_1179410951 11 Left 1179410943 21:41162774-41162796 CCTACTTCCCTCTGGTCCCAAAG No data
Right 1179410951 21:41162808-41162830 GTCATTTGAAGAAGGCGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179410943 Original CRISPR CTTTGGGACCAGAGGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr