ID: 1179411798

View in Genome Browser
Species Human (GRCh38)
Location 21:41168190-41168212
Sequence AGTCGCTGAGCCGCGGCTGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179411788_1179411798 4 Left 1179411788 21:41168163-41168185 CCTGCCCGCAGCCCCGCGCGCCG 0: 1
1: 0
2: 14
3: 90
4: 659
Right 1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 116
1179411781_1179411798 29 Left 1179411781 21:41168138-41168160 CCGCCGGTCCCGGTGCGCGCCCA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 116
1179411794_1179411798 -9 Left 1179411794 21:41168176-41168198 CCGCGCGCCGGCCGAGTCGCTGA 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 116
1179411785_1179411798 10 Left 1179411785 21:41168157-41168179 CCCATCCCTGCCCGCAGCCCCGC 0: 1
1: 0
2: 4
3: 71
4: 656
Right 1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 116
1179411786_1179411798 9 Left 1179411786 21:41168158-41168180 CCATCCCTGCCCGCAGCCCCGCG 0: 1
1: 0
2: 10
3: 75
4: 747
Right 1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 116
1179411791_1179411798 -1 Left 1179411791 21:41168168-41168190 CCGCAGCCCCGCGCGCCGGCCGA 0: 1
1: 0
2: 3
3: 31
4: 265
Right 1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 116
1179411787_1179411798 5 Left 1179411787 21:41168162-41168184 CCCTGCCCGCAGCCCCGCGCGCC 0: 1
1: 0
2: 7
3: 61
4: 572
Right 1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 116
1179411784_1179411798 20 Left 1179411784 21:41168147-41168169 CCGGTGCGCGCCCATCCCTGCCC 0: 1
1: 0
2: 4
3: 40
4: 321
Right 1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 116
1179411783_1179411798 21 Left 1179411783 21:41168146-41168168 CCCGGTGCGCGCCCATCCCTGCC 0: 1
1: 0
2: 0
3: 31
4: 233
Right 1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 116
1179411792_1179411798 -7 Left 1179411792 21:41168174-41168196 CCCCGCGCGCCGGCCGAGTCGCT 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 116
1179411793_1179411798 -8 Left 1179411793 21:41168175-41168197 CCCGCGCGCCGGCCGAGTCGCTG 0: 1
1: 0
2: 1
3: 14
4: 73
Right 1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 116
1179411790_1179411798 0 Left 1179411790 21:41168167-41168189 CCCGCAGCCCCGCGCGCCGGCCG 0: 1
1: 0
2: 7
3: 52
4: 420
Right 1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 116
1179411782_1179411798 26 Left 1179411782 21:41168141-41168163 CCGGTCCCGGTGCGCGCCCATCC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179411798 Original CRISPR AGTCGCTGAGCCGCGGCTGC CGG Exonic
900331995 1:2139904-2139926 CGTCTCTGAGCTGTGGCTGCTGG + Intronic
900372717 1:2339387-2339409 ACTCCCTGAGTCGGGGCTGCAGG + Intronic
900495879 1:2975795-2975817 AGACGCAGAGCCGAGTCTGCAGG - Intergenic
900595182 1:3477205-3477227 AGTCGCTGAGGAGCGGGAGCTGG + Intronic
900933883 1:5753424-5753446 AGCCTCTGAGCCGGGGGTGCTGG - Intergenic
901435648 1:9245850-9245872 AGTTGCTGAGCCACCGCTACAGG - Intronic
901438666 1:9264464-9264486 CGGCGCAGAGCCGCTGCTGCAGG - Exonic
902465235 1:16613386-16613408 AGGCGCGGCGGCGCGGCTGCCGG - Exonic
903155568 1:21440277-21440299 AGGCGCGGCGGCGCGGCTGCGGG + Intronic
904877952 1:33671123-33671145 ATTCCCTGAGCCACGGCTTCAGG - Intronic
910963394 1:92784885-92784907 AGACGCGGCGGCGCGGCTGCCGG - Intronic
912746311 1:112248387-112248409 AGAGGCTGAGCAGAGGCTGCAGG - Intergenic
913240454 1:116825593-116825615 AGCAGCTGAGCCGGGGCTGGGGG - Intergenic
915617049 1:157046426-157046448 AGAGGGTGAGCCGCAGCTGCGGG - Intergenic
922586410 1:226737555-226737577 GCGCGCGGAGCCGCGGCTGCCGG - Exonic
923990946 1:239436348-239436370 TGTCGCAGAGCAGAGGCTGCAGG + Intronic
1071262378 10:83932432-83932454 AGTCCCTGAGCTGGGCCTGCTGG - Intergenic
1071487456 10:86112022-86112044 AGTGGCTGAGGCAAGGCTGCAGG + Intronic
1073064433 10:100749867-100749889 CGTGGCTGACCCGCAGCTGCCGG - Exonic
1075645159 10:124092291-124092313 AGGCGGGGAGCCGGGGCTGCGGG - Intronic
1077543881 11:3160478-3160500 ATTCGCTGGGCTGCGGCTCCAGG - Intronic
1082974609 11:59059522-59059544 AGTCACTGAGCCACGGGTGGAGG - Intergenic
1082979030 11:59103318-59103340 AGTCACTGAGCCACGGGTGGAGG - Intergenic
1083215384 11:61215521-61215543 AGAGGCTGAGCTGCAGCTGCTGG - Intergenic
1083218268 11:61234350-61234372 AGAGGCTGAGCTGCAGCTGCTGG - Intergenic
1086375413 11:86195169-86195191 AGGCGGTGAGCCCCGGCAGCTGG + Intergenic
1096495492 12:52037249-52037271 AGCGGCTGCGGCGCGGCTGCAGG + Intronic
1098748688 12:74269393-74269415 AGTAGCTGTGCCGCAGTTGCTGG + Intergenic
1100234860 12:92650817-92650839 AGTGGCTGAGGCACGGCTGCTGG + Intergenic
1101029205 12:100643543-100643565 AGTAGCTGTGCCGCAGTTGCTGG - Intergenic
1103480151 12:121245452-121245474 AGACGCTGAGCAGTGGCTGAGGG - Intronic
1106395723 13:29379269-29379291 AGTGGCAGAGCCAAGGCTGCTGG + Intronic
1113269631 13:108659429-108659451 ACTCGCTGAGCAGGGGCTTCTGG + Intronic
1113911498 13:113843461-113843483 GGTCACTGAGCCCCGGCTACCGG - Intronic
1114007989 14:18333906-18333928 AGTGCCTGAGCCGGGGCTGCAGG + Intergenic
1119324659 14:73752765-73752787 AGTCTCTGAGCAGCTGCTGCAGG + Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122672932 14:103385768-103385790 AGTGGCGGAGCCGAGCCTGCGGG - Exonic
1130460183 15:84154495-84154517 CCTCTCTGAGCCTCGGCTGCTGG + Intergenic
1132063059 15:98708462-98708484 AGTCCCTGAGCCTTGGCAGCTGG + Intronic
1132315983 15:100890958-100890980 AGTCCCTGAGTGGCAGCTGCTGG + Intronic
1135422318 16:22313651-22313673 AGAAGCTGGGCCGCAGCTGCAGG - Exonic
1135423751 16:22322239-22322261 AGGGGCTGAGCCGGGGTTGCAGG + Intronic
1142037164 16:87869452-87869474 GCTCGCTGGGCCGCGGCTCCCGG - Exonic
1142155325 16:88530290-88530312 AGTCCCTGAGGGGCAGCTGCGGG + Intronic
1142305121 16:89280436-89280458 CGTCGCTGAGCCGGGGCTGGAGG - Exonic
1143723171 17:8828011-8828033 AGTCCCTGAGCCGGGGATGTGGG + Intronic
1146182584 17:30707616-30707638 AGTCCCTGAAGCGGGGCTGCTGG - Intergenic
1146794285 17:35770224-35770246 GGTCCCTGAGCCGCCGCCGCGGG - Exonic
1146907817 17:36629403-36629425 AGTGGGTGAGCTGCGGCGGCAGG + Intergenic
1151727269 17:75892347-75892369 AGACGAGGAGCAGCGGCTGCGGG - Exonic
1152212496 17:79009806-79009828 AGCCGCAGAGCAGAGGCTGCCGG - Exonic
1152622039 17:81369828-81369850 AGTCGCTGAGCCTCAGTTCCTGG + Intergenic
1152757342 17:82092514-82092536 AGCCGATGAGCAGCGGCTCCTGG + Exonic
1157927830 18:51785416-51785438 AGTCCATGAGCCTCTGCTGCTGG - Intergenic
1161425290 19:4199676-4199698 TGGGGCTGAGCCGCAGCTGCAGG - Exonic
1162372298 19:10286925-10286947 AGTCGAGGAGGCGGGGCTGCGGG + Intergenic
1162633171 19:11944916-11944938 AGTAGCTGTGCCACAGCTGCTGG - Intronic
1162976238 19:14208189-14208211 AGTCCCTGAAGCGGGGCTGCTGG + Intergenic
1163664982 19:18598944-18598966 ACTAGCTGAGCCTCGGCTGAGGG + Intronic
927847199 2:26477648-26477670 AGGAGCTGAGCTGTGGCTGCTGG - Exonic
929760511 2:44802587-44802609 ACTCGCTCAGCCGCGGTGGCGGG + Intergenic
930741447 2:54836528-54836550 AGTCGCAGGGCTGGGGCTGCAGG - Intronic
931517829 2:63059934-63059956 AGTCCCTGGGCAGCGGCGGCGGG + Intergenic
936094829 2:109523645-109523667 AGCCGCTGAGAAGCAGCTGCTGG + Intergenic
936427708 2:112434657-112434679 AGCCGCTGAGGGGCTGCTGCGGG + Intergenic
947103225 2:226643875-226643897 AGTTGCTGAGCTGCTGCTGAAGG + Intergenic
948364964 2:237448824-237448846 AGTCACTGTGGCCCGGCTGCTGG - Intergenic
1173248597 20:41352703-41352725 AGTCCCAGAGCTGGGGCTGCTGG + Intronic
1175624886 20:60481925-60481947 AGTCTCTGAGCAGCCACTGCAGG - Intergenic
1175888167 20:62303787-62303809 TGTCCCTGAGCCGCAGCAGCAGG + Intronic
1176150846 20:63590026-63590048 TGTCTCTCAGCCGCGGCAGCAGG - Exonic
1176374535 21:6080555-6080577 AGCCGCTGAGGGGCTGCTGCGGG - Intergenic
1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG + Exonic
1179748940 21:43457690-43457712 AGCCGCTGAGGGGCTGCTGCGGG + Intergenic
1180432496 22:15264716-15264738 AGTGCCTGAGCCGGGGCTGCAGG + Intergenic
1180515068 22:16132696-16132718 AGTGCCTGAGCCGGGGCTGCAGG + Intergenic
1182046602 22:27279079-27279101 ATGTGCTGAGCCCCGGCTGCTGG - Intergenic
1182735886 22:32532184-32532206 ATTCACTGAGCCGCTGCTCCAGG - Intronic
1185338363 22:50280806-50280828 CATCCCTGAGCCGCGGCGGCCGG - Exonic
949898788 3:8792816-8792838 AGTGGCTGAGCCAAGACTGCAGG - Intronic
950614642 3:14148888-14148910 ACTTGCTGAGCCCCAGCTGCGGG - Exonic
954577310 3:51683742-51683764 AGTGGCTGAGGAGGGGCTGCAGG - Intronic
961664399 3:128487034-128487056 AGACCCTGAGCCGCCGCCGCCGG - Exonic
961892795 3:130144574-130144596 AGTAGCTGTGCCACAGCTGCTGG - Intergenic
966933741 3:184692060-184692082 AGTTGGTGAGCTGCGGCTCCAGG - Intergenic
967807869 3:193731173-193731195 GGTCGCAGAGACCCGGCTGCTGG - Intergenic
968221350 3:196942467-196942489 AGTCGCTGCGCAGCGCCTTCAGG + Exonic
969214594 4:5711622-5711644 AGTCGCAGAGCCGGGGCTCCGGG - Intronic
969226115 4:5799492-5799514 AGTGGCAGCGCCGGGGCTGCAGG + Intronic
969785686 4:9455417-9455439 AGTAGCTGCGCCACAGCTGCTGG + Intergenic
969789112 4:9479827-9479849 AGTAGCTGCGCCACAGCTGCTGG + Intergenic
975683329 4:76897256-76897278 AGACGCAGGGCCGCTGCTGCTGG - Exonic
978361018 4:107931461-107931483 CGTCGCTGAGTGGCGGCGGCGGG + Exonic
981061269 4:140427623-140427645 AGTCGCTGCTGCGCGGCCGCCGG - Exonic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
985644875 5:1080161-1080183 TGTCTCTGAGCCGCGGGTGGAGG - Intronic
986151128 5:5131308-5131330 AGTGGCTGAGGCGCTGCTGCTGG + Intergenic
987050591 5:14144176-14144198 ACCCGCGAAGCCGCGGCTGCCGG - Intronic
993651598 5:90529350-90529372 AGGCGCTGAGCCTCGGCCACAGG - Intronic
995435373 5:112129084-112129106 AGGCCCTGAGCCACTGCTGCTGG + Intergenic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1003045755 6:2731396-2731418 GGTCACTGAGCCATGGCTGCTGG + Intronic
1016893637 6:149032176-149032198 AGTGGCCAAGCCGCTGCTGCCGG + Intronic
1019620100 7:1987687-1987709 AGACGTGGAGCCGGGGCTGCCGG - Intronic
1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG + Intronic
1032197540 7:129798301-129798323 AGGCGCTGGGCCCTGGCTGCAGG + Intergenic
1034244963 7:149637014-149637036 AGTGGCTGAGCCACGGCCCCAGG + Intergenic
1035327271 7:158073293-158073315 AGCCTGTGAGCCGCGGCTGCAGG + Intronic
1038147898 8:24914813-24914835 TGTCGCTGAGCTGCCGCTCCAGG - Exonic
1038319174 8:26512832-26512854 AGTAGCTGAGCCACGGCCACCGG - Intronic
1049354522 8:142181076-142181098 ACTCGCTGAGCCGCGAGCGCTGG + Intergenic
1049796857 8:144500959-144500981 CGGCGCTCACCCGCGGCTGCCGG - Exonic
1053707180 9:40767796-40767818 CGTGCCTGAGCCGGGGCTGCAGG - Intergenic
1054417093 9:64888564-64888586 CGTGCCTGAGCCGGGGCTGCAGG - Intergenic
1058201875 9:102053494-102053516 ATTTGCTGAGCAGCAGCTGCAGG - Intergenic
1058662910 9:107283009-107283031 AGAGGCGGAGCCGCGGCAGCCGG + Intergenic
1060811044 9:126611709-126611731 AGTCGCCCAGCCCCGGTTGCAGG + Intergenic
1061665341 9:132157578-132157600 AGTCGCAGAGCTGCTGGTGCTGG + Intergenic
1061863246 9:133478610-133478632 AGTGGCTGAGCCTCTGGTGCTGG + Intronic
1061940937 9:133883439-133883461 AGTGGCTGAGCTGCTGCAGCAGG - Intronic
1062642993 9:137531165-137531187 AGTCGCTGGACCCCGGCTGTTGG - Intronic
1185910014 X:3972525-3972547 AGTAGCTGTGCCGCAGTTGCTGG + Intergenic
1196907903 X:120456139-120456161 ACTCGCTGGGCCGAGGCTGGAGG - Intronic
1197205366 X:123785084-123785106 AGTGGCTGAGCTGCTGGTGCTGG - Intergenic
1199743349 X:150756452-150756474 AGTGGCTGAGCTCTGGCTGCGGG + Intronic