ID: 1179414054

View in Genome Browser
Species Human (GRCh38)
Location 21:41184203-41184225
Sequence CTCAGGAAATATACTAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179414054_1179414057 10 Left 1179414054 21:41184203-41184225 CCTGCATTAGTATATTTCCTGAG 0: 1
1: 1
2: 2
3: 13
4: 168
Right 1179414057 21:41184236-41184258 AAAAGACCCTGAAACAGAGCGGG 0: 1
1: 2
2: 10
3: 42
4: 354
1179414054_1179414056 9 Left 1179414054 21:41184203-41184225 CCTGCATTAGTATATTTCCTGAG 0: 1
1: 1
2: 2
3: 13
4: 168
Right 1179414056 21:41184235-41184257 TAAAAGACCCTGAAACAGAGCGG 0: 1
1: 0
2: 2
3: 29
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179414054 Original CRISPR CTCAGGAAATATACTAATGC AGG (reversed) Intronic
901622814 1:10602647-10602669 ATTATGAAATATACTAATCCTGG + Intronic
902367983 1:15989866-15989888 CTCAGGAGGTAGACTACTGCAGG + Intergenic
902786113 1:18733722-18733744 CCCAGGAAACAAACTACTGCTGG + Intronic
905604936 1:39289391-39289413 GACAGGCAATATACAAATGCTGG - Intronic
906072553 1:43027694-43027716 CTCGGGAATTATACTGAGGCAGG - Intergenic
906871575 1:49487608-49487630 CTCAGGAAACATAATCATGGTGG - Intronic
907079675 1:51609688-51609710 CTCAAGAAATAAACCAGTGCTGG - Intronic
908346009 1:63233831-63233853 CTCAGGAAACATAATCATGGAGG + Intergenic
908552593 1:65224309-65224331 CTTAGGAAAAATACTAATCTAGG - Intronic
909798459 1:79774603-79774625 CTCAGGAAACATAATCATGGTGG + Intergenic
911972283 1:104453316-104453338 CTCAGGAAATGTAGTCATGGAGG - Intergenic
912061091 1:105671405-105671427 CTCAGGATGTATGCTCATGCAGG + Intergenic
913366032 1:118039860-118039882 CTAAGGAAATAAAGTAATGGTGG + Intronic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
918994068 1:191733084-191733106 CTCAGGGAATATATTTATTCAGG - Intergenic
919528558 1:198685447-198685469 ATCAGTAAATATAATAATGATGG - Intronic
919993639 1:202727760-202727782 CTCAAGACATATACTAAACCCGG + Exonic
920253199 1:204636433-204636455 CTTTTAAAATATACTAATGCTGG + Intronic
921355722 1:214282391-214282413 CTCAGTAAATTTACTAAGGCAGG + Intronic
922174001 1:223180751-223180773 CTCAGGAAACAAACTCATGCAGG - Intergenic
922321400 1:224491165-224491187 CTCAGTAAATACACTAATAAGGG - Intronic
922423564 1:225474943-225474965 CTGAGAAAATACACGAATGCAGG - Intergenic
924006398 1:239616619-239616641 CTCAGGAAATATAATACTGCTGG - Intronic
1064485016 10:15777759-15777781 CACAGGAACTATACTATTGAAGG + Intergenic
1064673372 10:17738044-17738066 CTCAAGAAATAGAGTACTGCAGG + Intergenic
1065517061 10:26534436-26534458 CTCAGGAAATTTACTAACTCAGG - Intronic
1070256508 10:74817644-74817666 GTTAGGAAATATATTCATGCAGG + Intergenic
1071161001 10:82745087-82745109 CTAAGGAAATATAAAAATGGAGG + Intronic
1077389064 11:2291043-2291065 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389086 11:2291150-2291172 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389097 11:2291206-2291228 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389150 11:2291477-2291499 CTCTGTGAATATACTAAAGCGGG - Intergenic
1077389247 11:2291960-2291982 CTCTGTGAATATACTAAAGCGGG - Intergenic
1077389291 11:2292174-2292196 CTCTGTGAATATACTAAAGCGGG - Intergenic
1077389324 11:2292338-2292360 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389367 11:2292560-2292582 CTCTGTGAATATACTAAAGCGGG - Intergenic
1079305046 11:19314555-19314577 CTCTCGAAATATACTGATGCTGG - Intergenic
1081203818 11:40250927-40250949 CTCAGGAAATAGATAAATGTAGG - Intronic
1081753426 11:45528128-45528150 CTCAGGAAATTCACTGCTGCAGG - Intergenic
1085435640 11:76498712-76498734 TGCACTAAATATACTAATGCAGG - Intronic
1085965234 11:81515089-81515111 CTCAGGAATTAGACTACTTCAGG - Intergenic
1086927796 11:92659317-92659339 CTCAGGGAATAAAATAATACAGG + Intronic
1088148420 11:106713805-106713827 CCAAAGAAATATACTAATGTTGG - Intronic
1092130063 12:6104793-6104815 CACAATAAATATACTAGTGCAGG - Intronic
1093336428 12:17911303-17911325 TTCAGGAAACATAAAAATGCAGG - Intergenic
1093570855 12:20664133-20664155 CTCAGGAAACATAATCATGGTGG - Intronic
1094017727 12:25882744-25882766 CTGAGGAAATAGACAAATACAGG - Intergenic
1096059377 12:48683579-48683601 CTCAAGAAAAACACTAAGGCTGG + Intergenic
1099710369 12:86216133-86216155 CTCCAAAAATATACTAATTCTGG - Intronic
1100651790 12:96598174-96598196 CTCAGGAAATCAACTAATATTGG - Intronic
1102196805 12:111032149-111032171 CTGGGTAAATATATTAATGCAGG - Intergenic
1102614439 12:114140972-114140994 CTCAGGACCTAGATTAATGCAGG + Intergenic
1107564814 13:41591026-41591048 ATCTGGAAATATAATAATGGGGG + Intronic
1110624574 13:77638453-77638475 CTCAGGAAATGCACTGATGTTGG - Intronic
1111483878 13:88869251-88869273 CTCAGGAAATAAAATCATGGTGG - Intergenic
1113013102 13:105793419-105793441 CTCAGGAAACATATTCATGGCGG + Intergenic
1117311745 14:54532628-54532650 TTCTGGAAATACACTACTGCTGG - Intronic
1118772549 14:68951886-68951908 GCCAGGTACTATACTAATGCTGG + Intronic
1120210099 14:81625585-81625607 CACAGGAAATATACTCTTGAAGG - Intergenic
1126395342 15:48209660-48209682 CTCAGGAAAGATGCTAATAAAGG + Intronic
1128198414 15:65781729-65781751 CTTTGGAAAGATACTGATGCTGG + Intronic
1129048083 15:72754896-72754918 CTCTGGAAATAAACTGATGAAGG + Intronic
1129309112 15:74693191-74693213 CTGATACAATATACTAATGCAGG + Intronic
1129629483 15:77243204-77243226 TTAAGCAAATATACTAAAGCAGG + Intronic
1132035084 15:98476099-98476121 CTCAGGAAAAAAAATAATGGTGG + Intronic
1137442228 16:48507309-48507331 CTCAGGAAAAATTTTAAGGCCGG - Intergenic
1140180893 16:72717431-72717453 CTCAATAAATATACTAATGCAGG - Intergenic
1150052352 17:61977450-61977472 CTCAAGAAAAATAATAATGTTGG - Intronic
1156782664 18:40869886-40869908 TTCAAGAAATATACTAATACTGG + Intergenic
1157169219 18:45386583-45386605 CTCAGTTAATCTGCTAATGCTGG - Intronic
1157877296 18:51285753-51285775 CTCAGCAAATTTCCCAATGCTGG + Intergenic
1164898497 19:31898103-31898125 CTCAGGAAACATAATCATGGTGG + Intergenic
1167484886 19:49756757-49756779 CCCAGGAAATAGAATAAGGCAGG + Intronic
1167821740 19:51934649-51934671 TTCAGGAAATATACTCCTCCAGG + Intronic
1168682249 19:58324518-58324540 CACATAAAATATACTAATGATGG - Intergenic
925494409 2:4430401-4430423 CTCAGGAAATATCATAAATCTGG + Intergenic
926994565 2:18720537-18720559 CTCTGGAAATAAACCACTGCTGG - Intergenic
929968080 2:46550512-46550534 CTCAGGAAACATGCAAAGGCCGG - Intronic
932094995 2:68839539-68839561 CTCTGGAAAGATAATATTGCAGG - Intergenic
932519667 2:72397322-72397344 GTAAGAAAATATACTATTGCTGG + Intronic
932848134 2:75155653-75155675 CACAAGAAATATAATAATGGAGG - Intronic
938015319 2:127862470-127862492 CTCAGGAAAAATACCAAGTCTGG - Exonic
939716691 2:145592686-145592708 CTCTGGAAATATCTTACTGCTGG + Intergenic
939718294 2:145613872-145613894 TTGAGGAATTATACTACTGCTGG + Intergenic
941452801 2:165679536-165679558 TTCAGGATATAAACTATTGCAGG - Exonic
942568659 2:177291289-177291311 CTCAAGAAAAATAATAATGCAGG - Intronic
946151281 2:217773152-217773174 CTCAGGAAACTTACAAATGGTGG - Intergenic
946806313 2:223474388-223474410 CTCAGGATATATATTAACGCAGG - Intergenic
946867358 2:224054176-224054198 CTCAGGCAACATACTAAGGGTGG + Intergenic
946972793 2:225113876-225113898 CTGCAGAAATATACAAATGCTGG + Intergenic
947995396 2:234523116-234523138 CTCAGGAAACACAATAATGGCGG - Intergenic
948538016 2:238661513-238661535 TTCAGGAGATATTCTAATGGGGG - Intergenic
1169988201 20:11470306-11470328 CTGAGGAAATAGAATAATGTTGG - Intergenic
1172830051 20:37825839-37825861 CTGAGGAAAAATGCTAATTCTGG - Intronic
1173703205 20:45091468-45091490 CTCAGGAAATACAGGAATGAGGG - Intergenic
1174242934 20:49152769-49152791 ATCAGGTAATCTACAAATGCTGG + Intronic
1177679758 21:24351529-24351551 CTCAGGAAACATAATCATGGTGG + Intergenic
1179414054 21:41184203-41184225 CTCAGGAAATATACTAATGCAGG - Intronic
950239181 3:11352745-11352767 CTCAGGAAATATAGAAGAGCAGG + Intronic
950654733 3:14429534-14429556 CTCAGGAAAGAGATTAAGGCTGG - Intronic
951113218 3:18830531-18830553 GTCTGGAAATGTACTACTGCAGG + Intergenic
955442874 3:58976241-58976263 GCCAGGAAATATCCTAATTCTGG + Intronic
956470976 3:69566577-69566599 TTCAGGAAATATTCTAGTCCAGG + Intergenic
956868014 3:73388277-73388299 CTCATGAACTATACTCATGGAGG - Intronic
959336902 3:105078719-105078741 CTCAGGAAACTTACAATTGCAGG + Intergenic
959988261 3:112600808-112600830 TTCAGGAAATATAATAATGAGGG - Intergenic
960722435 3:120638117-120638139 CTCAGGAAATACAATCATGGTGG - Intronic
964340324 3:155701868-155701890 CTCAGGATATATTGTAATTCAGG - Intronic
965737032 3:171831620-171831642 ATCAAGAAATATAGTAATGAGGG - Intergenic
966217533 3:177518878-177518900 CTCAGGAAACATAATCATGGTGG + Intergenic
966774606 3:183532976-183532998 CTCAGAAAATGTACTAATTGAGG + Intronic
967319553 3:188182107-188182129 CTCAGGAAATGTGCTGAGGCTGG - Intronic
968219860 3:196928782-196928804 TTCAGGAAATTTACTAGTTCTGG - Intronic
970598231 4:17619142-17619164 CTAAGGAAATGTACCAAAGCAGG - Intronic
970904791 4:21203105-21203127 CTCAGGAAAATGACTCATGCAGG + Intronic
973158698 4:46990879-46990901 ATCAGTCAATATACAAATGCTGG + Intronic
973619167 4:52710651-52710673 CTTAGTAAAGAGACTAATGCAGG - Intergenic
974552152 4:63390735-63390757 TTCAAGAAATATACCAATGAGGG + Intergenic
977837673 4:101663954-101663976 GCCAGGAAATATTCTAGTGCAGG + Intronic
978972343 4:114824130-114824152 CTCAGAATAAATACTACTGCTGG - Intergenic
980625334 4:135367951-135367973 CTCAGTAAACATACTAATAGGGG - Intergenic
980914093 4:139018138-139018160 ATCAGGCAATATACTCATTCTGG - Intronic
984306939 4:178005491-178005513 CTCAGGAAACATAATCATGGTGG + Intergenic
984369751 4:178847564-178847586 CTCAGGAAATTCACTATTTCTGG - Intergenic
988001176 5:25350815-25350837 CTAACGAAATATAAGAATGCTGG + Intergenic
990182764 5:53180771-53180793 CTCAGGAAACATAATCATGACGG - Intergenic
990404204 5:55471598-55471620 CTCAGAAACTATAATAATGCTGG + Intronic
990785642 5:59415907-59415929 CTCAGGATATAGACCAACGCTGG - Intronic
991992245 5:72351583-72351605 CTCAGGAAATACAGTCATGGGGG + Intronic
993200085 5:84804833-84804855 CACTGGAAATATACTAACGGTGG - Intergenic
993709871 5:91214110-91214132 CTCTGGAAATTTAATAATGATGG + Intergenic
993800014 5:92320603-92320625 CTCAGGAAATGCAATCATGCTGG - Intergenic
995036989 5:107545381-107545403 CTCAGGAAATATTTTCCTGCGGG - Intronic
996649218 5:125853191-125853213 CTTAGGAAAAATACAATTGCTGG - Intergenic
997707584 5:135972562-135972584 CTCTGGAAATGAACTAATCCTGG - Intergenic
998700695 5:144696064-144696086 AGCAGGAAATAAACTAATACTGG - Intergenic
1003594426 6:7461693-7461715 CTCAGGATCTAGACCAATGCTGG - Intergenic
1004910675 6:20279885-20279907 TTCAGGAAGGAAACTAATGCTGG + Intergenic
1005879776 6:30047260-30047282 CTCAGGAAACACAATAATGGTGG + Intergenic
1005969957 6:30752990-30753012 CTCAAGAAATCTATTAATTCAGG - Intergenic
1006841446 6:37030505-37030527 CTTAGAAAATATACTAATAAGGG - Intergenic
1008243586 6:49143605-49143627 CTCAGGAAAAACACTAGTGTTGG - Intergenic
1008255106 6:49289105-49289127 CTCAGGAAATGCACTGATGTTGG + Intergenic
1009944854 6:70331288-70331310 GTCAGGAAAAAAACTGATGCTGG - Intergenic
1011981560 6:93385853-93385875 CTCAGGAAACATAATCATGGTGG + Intronic
1013362632 6:109408706-109408728 CTAAGGAATTAAATTAATGCAGG - Intronic
1015189673 6:130459141-130459163 CTCATCAAAAATACAAATGCTGG + Intergenic
1015536400 6:134271480-134271502 CTCAGGGAAAATAGAAATGCTGG + Intronic
1015726540 6:136305289-136305311 CTCAGGAAAGATACTAATGCTGG + Intergenic
1016463583 6:144304040-144304062 CTCAGAAATTATAATAATTCAGG + Intronic
1017682676 6:156879984-156880006 CTTTGGAAATCTTCTAATGCTGG - Intronic
1023361396 7:39419600-39419622 TTCATGAGATATAGTAATGCTGG - Intronic
1024093264 7:45965072-45965094 CAGAGGCAATGTACTAATGCTGG + Intergenic
1027857093 7:83525975-83525997 CTAAAGAAATATATTGATGCTGG - Intronic
1031219171 7:118942185-118942207 CTGATGATATATACTAATGAGGG + Intergenic
1031548267 7:123077173-123077195 CTCAGGAAATTTACTAGCTCGGG + Intergenic
1033635342 7:143206860-143206882 CTCAGGCCCTATACTAATGTGGG + Intergenic
1035210426 7:157323953-157323975 TTCAGGAAAAAAACAAATGCTGG - Intergenic
1036457476 8:8922579-8922601 ATCAGAAAATAGACTAATACAGG + Intergenic
1037384374 8:18322021-18322043 CTCAGGAAACTTACAAATGGCGG + Intergenic
1039091978 8:33840698-33840720 CAAAGAAAATATACTAATGATGG - Intergenic
1039995638 8:42530353-42530375 TTCAGGAAATATACTCAGGTTGG + Intronic
1040362668 8:46682835-46682857 CTCAGCAAATAAAATAATGGGGG - Intergenic
1041393519 8:57368740-57368762 CTAAGGAAAAAAACAAATGCAGG + Intergenic
1042578833 8:70253697-70253719 CTCATGAAAAAGAATAATGCTGG + Intronic
1043102330 8:76061240-76061262 CTCAGGAAACATAATCATGGTGG - Intergenic
1044028608 8:87206134-87206156 CACAGGTAATAGACTAATGTGGG + Exonic
1046533742 8:115481724-115481746 CTCAGCAGATATACTTATCCAGG - Intronic
1047151369 8:122267269-122267291 CTCAGGAAACATAATCATGGCGG + Intergenic
1047239224 8:123071215-123071237 CTCAAAAAAAATACTAATGCAGG - Intronic
1049001040 8:139825865-139825887 CACAGGAAATATTCTGATTCAGG - Intronic
1050722172 9:8602695-8602717 CTCTGGAAAAATATTGATGCAGG - Intronic
1051499188 9:17758643-17758665 ATCAGGAATTATACTAAAGAGGG - Intronic
1056163846 9:83923180-83923202 CTCATGAAATATAGGAATGAAGG + Intergenic
1058019372 9:100070955-100070977 CTCAGGCAATATACTATAGCAGG + Intronic
1060898148 9:127232607-127232629 ATCAGGAAAGATGCTAATGCAGG - Intronic
1061525900 9:131162035-131162057 CACATAAAATATACTAATGCTGG - Intronic
1186467642 X:9796477-9796499 CATAGGAAATGTACTGATGCTGG - Intronic
1189851664 X:45183511-45183533 CACAGGAAATATTCTAAAACAGG + Intronic
1192580007 X:72273181-72273203 CTGAGGAAATATGTAAATGCAGG - Intronic
1195179966 X:102348642-102348664 CTCAGGAAAAATAACAAAGCTGG - Intergenic