ID: 1179414200

View in Genome Browser
Species Human (GRCh38)
Location 21:41185297-41185319
Sequence GGGGCTAAACAAATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179414192_1179414200 5 Left 1179414192 21:41185269-41185291 CCATAGAGATCTAGAGTTGGGTG 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 194
1179414189_1179414200 13 Left 1179414189 21:41185261-41185283 CCTAAATTCCATAGAGATCTAGA 0: 1
1: 0
2: 0
3: 18
4: 159
Right 1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179414200 Original CRISPR GGGGCTAAACAAATGGAGGA AGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900271206 1:1789899-1789921 AGGGCTAATCTCATGGAGGAAGG + Intronic
903124708 1:21239717-21239739 GGCGCTGGACAAATGGATGATGG + Intronic
903125108 1:21242497-21242519 TGGGCTGAACACAAGGAGGAGGG + Intronic
903207296 1:21792192-21792214 GGGGCTAGACAGAATGAGGATGG - Intergenic
904840790 1:33370643-33370665 GGGGAGAAAGAAATGGATGAGGG - Intronic
904893852 1:33799508-33799530 AGGGAGAAATAAATGGAGGAAGG - Intronic
905342769 1:37290644-37290666 GAGGGTACAAAAATGGAGGAAGG - Intergenic
905824109 1:41016295-41016317 GGGGCCAAACTGAGGGAGGAAGG + Intronic
906129173 1:43445875-43445897 GGTGCTATAGAAAAGGAGGAGGG - Exonic
906951209 1:50335649-50335671 GGGGAGAAAAAGATGGAGGAGGG + Intergenic
910241182 1:85087681-85087703 GGGGAAAAAAGAATGGAGGAGGG + Intronic
912558892 1:110536152-110536174 GGAGCTAAGCAAAGGGAAGAGGG + Intergenic
915025793 1:152828211-152828233 ATGGCTAAAGATATGGAGGAGGG + Intergenic
915782844 1:158572046-158572068 GGGGCTAGACAATTTCAGGAAGG + Intergenic
916575786 1:166065153-166065175 GTGGCTGGACAAGTGGAGGAGGG + Intronic
917062033 1:171051885-171051907 GGCACAAAACAAATGGAGGAGGG - Intronic
917243579 1:172975776-172975798 GGGGGTAAACAAGAGGAGGGTGG - Intergenic
921250673 1:213294912-213294934 AGTGCTAAACCAATGGAGAAGGG + Intergenic
1072188042 10:93060798-93060820 AGGGTTAAACGACTGGAGGAGGG + Intergenic
1073472784 10:103733429-103733451 TGGGCAAAGCTAATGGAGGAGGG - Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074515656 10:114166674-114166696 GTGGCTATACAAATGAAGGTGGG + Intronic
1076235756 10:128862728-128862750 GGTGGTGAAGAAATGGAGGAAGG + Intergenic
1080790041 11:35514438-35514460 GGGGCAAGATAAATGGAAGAGGG - Intronic
1082980585 11:59116939-59116961 GGGGCTTGTCAAATGGAGAAAGG - Intronic
1083248491 11:61449087-61449109 GTGGCTAGACAAAGAGAGGAAGG + Intronic
1084117796 11:67052114-67052136 GGGACTGTACACATGGAGGAGGG + Intergenic
1085836829 11:79965986-79966008 GTGGCTAAAGAAGAGGAGGAGGG - Intergenic
1085838698 11:79984790-79984812 AGGGCTTAACAGATTGAGGACGG + Intergenic
1086415996 11:86589321-86589343 GGAGCTAAATAAATGGGGGTAGG + Intronic
1087237227 11:95733483-95733505 GGGTCTGAGGAAATGGAGGAGGG - Intergenic
1090699465 11:129280335-129280357 GGGGCTGAACAAAAGGAACAGGG - Intergenic
1091488145 12:909246-909268 GGGGTAAAAAAAAGGGAGGAGGG - Exonic
1091723993 12:2833235-2833257 GGGGCCAAACACATGTAGGATGG + Intronic
1092240009 12:6830494-6830516 GGGGCTGAAGAAGAGGAGGATGG + Exonic
1092995399 12:13945142-13945164 GGGTCTAAACAAATTGTGGCAGG + Intronic
1093824779 12:23670601-23670623 GGAGCTATATAAATGGATGAAGG + Intronic
1094799029 12:34008713-34008735 GGGTCTTAGAAAATGGAGGAAGG - Intergenic
1097301840 12:58027229-58027251 GGTGCTGCACAAATGGAGTAGGG - Intergenic
1100872984 12:98931753-98931775 GGGGGTAAACACAGGGATGAAGG - Intronic
1101811586 12:108112429-108112451 GGAGCTAAACATAAGCAGGAAGG + Intergenic
1105247956 13:18669619-18669641 GGGACTAAAATAAGGGAGGAAGG - Intergenic
1105838625 13:24233084-24233106 GCGGCTGAATAAATGGAGGCTGG - Intronic
1107966526 13:45603033-45603055 GAGGCTTAAGACATGGAGGAGGG + Intronic
1109086445 13:57977875-57977897 AAGGCTAAGAAAATGGAGGATGG + Intergenic
1117071856 14:52064699-52064721 GGGGCCAGAGAAATGGATGAAGG - Intronic
1117941240 14:60967776-60967798 ATAGCTAAACAAATGGAAGAGGG - Intronic
1118939886 14:70323870-70323892 GTGCCTAGACAACTGGAGGAAGG - Intergenic
1121966193 14:98308174-98308196 GGAGGTAAAAAAAAGGAGGAGGG + Intergenic
1122183086 14:99970088-99970110 GGGCTTAAACAAATACAGGAAGG + Intergenic
1124044235 15:26133616-26133638 GGGGATAGACAAATAGACGAGGG + Intergenic
1128085306 15:64882384-64882406 GTGGCTAAACGAAGGGAGGGAGG - Intronic
1129127703 15:73458700-73458722 GGGGATAAAGAAATGGACAAAGG + Intronic
1129362388 15:75032060-75032082 GGGGAAAAACAAATGCAGGGAGG - Intronic
1131265077 15:90910948-90910970 GGGGCTCACCACTTGGAGGAAGG - Exonic
1131551225 15:93358713-93358735 GGGGCGAGGCAGATGGAGGAGGG + Intergenic
1131671128 15:94620532-94620554 GAGGCCAAACAGATGGAGGCAGG - Intergenic
1132156474 15:99499312-99499334 GAGGCTCAGCAAATGTAGGAGGG - Intergenic
1132378483 15:101348677-101348699 GGGGAGATTCAAATGGAGGAAGG - Intronic
1133006128 16:2882787-2882809 GGGGCTAAACTAATAGACGAGGG + Intergenic
1133362013 16:5181614-5181636 GGGGCTACAGAAAGGGTGGATGG + Intergenic
1134852268 16:17489613-17489635 TGGATTAAACGAATGGAGGAAGG + Intergenic
1139461100 16:67123178-67123200 GTGGCAAAACTAAAGGAGGAAGG - Intronic
1139895612 16:70286135-70286157 GGGGGTAAACAAATGAATGTGGG - Intronic
1141518135 16:84559883-84559905 GGGGAGAAGCAACTGGAGGAGGG + Intergenic
1142523062 17:518599-518621 GGGAGTAAAGAAATGGAGGAAGG + Exonic
1142523731 17:523062-523084 GGGGTTAGACAAAAGGTGGAAGG + Intronic
1143180256 17:4980143-4980165 GGGGCCAGACATATGGAGGGGGG - Exonic
1143729345 17:8872052-8872074 GAGGGTAAAGAAATTGAGGAGGG - Intergenic
1144021449 17:11242225-11242247 GGTTCTGAAGAAATGGAGGAGGG - Intronic
1144804421 17:17954931-17954953 GGGGCTGAGCAAATGGATGGAGG - Intronic
1146821192 17:35984663-35984685 GGGGTTGAAGAAAAGGAGGAAGG - Intronic
1150148613 17:62792105-62792127 GGGTCAACACCAATGGAGGAGGG - Intronic
1150464380 17:65379611-65379633 AGGGACAAAGAAATGGAGGAAGG + Intergenic
1153293187 18:3521349-3521371 GGGGCTTATCATATGGAGCAGGG - Intronic
1154440895 18:14389509-14389531 GGGACTAAAATAAGGGAGGAAGG + Intergenic
1155111407 18:22718509-22718531 GGGGCACAACAAAGGGAAGAAGG - Intergenic
1156011847 18:32505577-32505599 GGGGATAGACCAATGGGGGAGGG - Intergenic
1158500605 18:57997361-57997383 CTGGCTTAAGAAATGGAGGAAGG - Intergenic
1161489751 19:4555439-4555461 GGGGCTGATCAGATGGAGGTTGG + Intronic
1162365344 19:10245360-10245382 GCGGCTAAAGCCATGGAGGAAGG + Intergenic
1164742856 19:30589599-30589621 GGGGATAAAGAAATGAAGCAAGG + Intronic
926927161 2:17998771-17998793 AGGTTTAAACAAATGGTGGAAGG + Intronic
926948997 2:18220906-18220928 AGGGCTAAAGAAAAGGGGGATGG + Intronic
931363007 2:61594529-61594551 GGGGCTTAACACCTAGAGGATGG + Intergenic
932396154 2:71449928-71449950 GGGGCTAACAGAATGGAGGGAGG + Intergenic
933099411 2:78233187-78233209 GTGGCTAAAGGAAAGGAGGATGG + Intergenic
935107605 2:100060097-100060119 GGGGTTGAACCAAAGGAGGATGG - Intronic
935809016 2:106777340-106777362 GGGGCTAGAGGAATGGGGGATGG - Intergenic
937030074 2:118731666-118731688 TGGGTTTAACAAATAGAGGAGGG + Intergenic
937775098 2:125767008-125767030 GGAGCTATAGACATGGAGGAAGG + Intergenic
937983468 2:127628196-127628218 GGGTCTGGACAAATGAAGGACGG - Intronic
939083650 2:137690692-137690714 TAGGCTAAAAAAATGGGGGATGG + Intergenic
940391939 2:153142352-153142374 GATGATAAACACATGGAGGAAGG + Intergenic
941680224 2:168390161-168390183 AGGGTTAAAAAAATGGAAGAGGG + Intergenic
942139087 2:172959357-172959379 GGGGCTTAAAATATGGAAGAGGG - Intronic
942764505 2:179438861-179438883 GGAGCTAATTACATGGAGGAGGG + Intergenic
943699461 2:190973960-190973982 GGTGCTCAACAAAGAGAGGAAGG - Intronic
944505201 2:200403879-200403901 GGGGCTTAAAAAGTGGAGAAAGG - Intronic
946760146 2:222985457-222985479 TAGGCTAAACACATGGAAGATGG + Intergenic
946817271 2:223592050-223592072 TGGGCTAGAAAAATGGAGGCTGG + Intergenic
946894842 2:224313035-224313057 GGGGATAAAGTTATGGAGGAAGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948940210 2:241191528-241191550 GTGGCTGAACAGCTGGAGGATGG - Intronic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1173174861 20:40756806-40756828 GGGGACAGGCAAATGGAGGAAGG - Intergenic
1173326415 20:42037551-42037573 GGGGCTAGACAAGGGCAGGAGGG + Intergenic
1174231126 20:49046396-49046418 GGGGATACAGAAACGGAGGAGGG - Exonic
1174301341 20:49584775-49584797 GGGGAGAAAGCAATGGAGGAGGG + Intergenic
1179026961 21:37686886-37686908 GGGGTTGAAAAAATGGAGGGTGG + Intronic
1179332367 21:40416238-40416260 GGGGAGAAACCAATGCAGGATGG - Intronic
1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG + Intronic
1180783506 22:18534702-18534724 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181127073 22:20708753-20708775 CGGCCTGAACAAAGGGAGGATGG - Intronic
1181240408 22:21474054-21474076 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1184030996 22:41894658-41894680 TGTGCTAAACAGTTGGAGGATGG - Intronic
1184204172 22:42990527-42990549 GGGGCAAAACACCTGGAGGGAGG + Intronic
1184346242 22:43914998-43915020 GGTGCAAAACAAAAGGACGATGG + Intergenic
949253332 3:2014751-2014773 GGGGCTACACAATAGGAAGATGG + Intergenic
950277179 3:11672015-11672037 GGAGATAAACAAATGGAGAAAGG - Intronic
951742421 3:25939151-25939173 GGGGCTGAAGAAATGTAGGCAGG + Intergenic
952331197 3:32365942-32365964 TGGGCTACAGAAATGAAGGAGGG - Intronic
952843295 3:37666395-37666417 GGAGCTAAACAAATGGTGGCTGG - Intronic
954886587 3:53880792-53880814 GGAGCTAACCAGAGGGAGGAGGG - Intronic
965695833 3:171407170-171407192 TGAGCTAAAGAAATGGCGGAAGG + Intronic
966599046 3:181756870-181756892 GGGGGTGAACAGCTGGAGGAGGG + Intergenic
968186164 3:196634684-196634706 GGGGCTGAAGAAGTGGAGGCTGG + Intergenic
968186205 3:196634823-196634845 GGGGCTAGAGAAGTGGAGGCTGG + Intergenic
968610507 4:1554737-1554759 GGGCATAAATAAATGGATGACGG - Intergenic
969329943 4:6468708-6468730 GGTGCTAAGCAAAGGAAGGATGG + Intronic
970580587 4:17470988-17471010 TGGGCTAAAGCAATGGAGGAAGG + Intronic
971170175 4:24225692-24225714 GGGTCTGAACAAATGGAAAATGG + Intergenic
971944397 4:33255276-33255298 GGGGCTGAAGGATTGGAGGAAGG + Intergenic
972969620 4:44557186-44557208 GCAGCAAAACAAATGGAGGAAGG - Intergenic
976519200 4:86006752-86006774 GGGGATAAGCAAATAGATGAAGG - Intergenic
978440628 4:108729925-108729947 GGGGCAATGCATATGGAGGAAGG + Intergenic
979373026 4:119912102-119912124 GGGGATTATCAAAGGGAGGAGGG - Intergenic
979853593 4:125604101-125604123 GAGGCTAAACATATAGAGAATGG - Intergenic
982301447 4:153883032-153883054 GGTGGTAGAGAAATGGAGGAGGG - Intergenic
982464553 4:155713852-155713874 GGTGCTCAAAGAATGGAGGATGG + Intronic
982582373 4:157195329-157195351 AGGGCTAAACCAATAGAGGCTGG - Intergenic
984636913 4:182120820-182120842 GGTGTTATAAAAATGGAGGAAGG + Intergenic
985608257 5:870839-870861 GGGGCTAAAGAAATTGGGGAGGG + Intronic
990604554 5:57395760-57395782 GGCGCTGAACACATGGAGGCTGG - Intergenic
992013182 5:72550970-72550992 GGTGCTAAAGGAATGAAGGAAGG + Intergenic
999515379 5:152296952-152296974 GGGGCTAAAGAAAGGGTAGAAGG + Intergenic
999555054 5:152731277-152731299 AGTGCAATACAAATGGAGGAAGG - Intergenic
1000262104 5:159597921-159597943 TGGCCTAAACAAATGAAGAATGG - Intergenic
1001834918 5:174823885-174823907 GGGTCTACACTAATGGAAGAAGG + Intergenic
1002472236 5:179442400-179442422 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002472264 5:179442578-179442600 GTGGGTGAACAAATGGATGAAGG + Intergenic
1004274439 6:14222902-14222924 GTGGCTAAAGAAATGGAAGGTGG + Intergenic
1005168923 6:22958691-22958713 TGGGGGAAACAAATGGAGGAAGG - Intergenic
1006413430 6:33889295-33889317 GGTGCTACACAAATGAAAGATGG - Intergenic
1007081512 6:39108432-39108454 GGGGGTAAACAAACTGACGAAGG + Intronic
1007866897 6:44981248-44981270 GGGTATAAATAAATGAAGGATGG + Intronic
1008119959 6:47602023-47602045 GGGTTTAAAACAATGGAGGAGGG - Intronic
1010808259 6:80264878-80264900 GGGGATTAAAAAATGGAGAAAGG + Intronic
1011038971 6:83009960-83009982 GAGAGTAGACAAATGGAGGAGGG + Intronic
1011995074 6:93576347-93576369 AGTGCTAAACAGATGGAGTACGG + Intergenic
1013183961 6:107741298-107741320 GGTGCTAAGCAGATGGAGGGAGG - Intronic
1015724810 6:136289388-136289410 CGGGCTGAAGAAATGGGGGAAGG + Intronic
1016737227 6:147492569-147492591 AGGGCTAGATAAATGGAGCAGGG - Intergenic
1016784311 6:147993291-147993313 GGGAGTAAAGAAAGGGAGGAGGG + Intergenic
1017754203 6:157515764-157515786 GTGGCTAAAGAAATGAAGGGTGG - Intronic
1017788014 6:157772435-157772457 GGGGCCAAACACAGGGATGAAGG + Intronic
1018789297 6:167134408-167134430 GGGCCTAAAAAGCTGGAGGAAGG - Intronic
1021143593 7:17057395-17057417 TGGCCTAAACAAATGCAGGATGG + Intergenic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1026236318 7:68529949-68529971 GTGGCTAAACTAACAGAGGAAGG + Intergenic
1026688088 7:72529769-72529791 GTGGCTACTCACATGGAGGAAGG + Intergenic
1026723313 7:72851618-72851640 GTGGCTACTCACATGGAGGAAGG + Intergenic
1029009884 7:97248494-97248516 GGAGCTAAACAGAGGGATGATGG + Intergenic
1036991626 8:13604713-13604735 TGGGGTCAACAAATGGAGAATGG - Intergenic
1038906630 8:31911573-31911595 GGGTCTTACCAGATGGAGGAGGG + Intronic
1039446443 8:37637037-37637059 GGGGCTCAACAAATGTTGGTGGG + Intergenic
1039943989 8:42114683-42114705 GGGACTAGTCAGATGGAGGAGGG - Intergenic
1040553294 8:48455986-48456008 GGGGCTAAAAACATAGATGACGG + Intergenic
1040566769 8:48574443-48574465 GGGGCAGAAAAAATGGAGGACGG - Intergenic
1040655960 8:49508035-49508057 GGGGCTACAGAGAGGGAGGAAGG - Intergenic
1043329965 8:79103600-79103622 GGGGCCTATCAAATGGTGGATGG + Intergenic
1043849477 8:85199510-85199532 GGTGTTAAATGAATGGAGGAAGG + Intronic
1044176653 8:89133168-89133190 GGGGCTACATAAATGAAAGAAGG + Intergenic
1044350745 8:91163271-91163293 GAGGCTAAAAAAATGGAGGGTGG - Intronic
1044804407 8:95990466-95990488 GGGGTGAAACAAATGGTCGAGGG - Intergenic
1045017188 8:98010091-98010113 GAGGCTAAAGAAGTGGAAGAGGG - Intronic
1045967358 8:108040674-108040696 GGTGTAAAACTAATGGAGGAAGG + Intronic
1046835544 8:118797066-118797088 AGGGCTCCACAAATGGAGGGTGG + Intergenic
1047947818 8:129900036-129900058 GGTGCTAAAAAAACGGAGAAAGG + Intronic
1053011394 9:34635790-34635812 GGGGCCAAACACATGGATGGTGG - Exonic
1054894642 9:70295011-70295033 GGGGCTCAATTAAAGGAGGAAGG + Intronic
1056903858 9:90627512-90627534 GGGGCTAAGGGAATGGAAGAAGG + Intronic
1057339636 9:94188356-94188378 GTCACTAAACAAATGGATGATGG - Intergenic
1058594462 9:106600794-106600816 GTTGCTAAACAATTGGATGAAGG - Intergenic
1058850765 9:109010125-109010147 GAGGCTAAAAAATGGGAGGATGG - Intronic
1060385907 9:123228121-123228143 TGGCCTAAACAACCGGAGGATGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187859858 X:23670819-23670841 GAGGCTACACAAAATGAGGAGGG - Intronic
1188869843 X:35359858-35359880 GGGGCAAAACACCTAGAGGAAGG - Intergenic
1189134935 X:38538964-38538986 GGTGCTATACCAATGAAGGAAGG - Intronic
1192173319 X:68870391-68870413 GGAGCTAAACTAATGGAGTTAGG - Intergenic
1192773084 X:74214099-74214121 GTGGGGAAAGAAATGGAGGAAGG + Intergenic
1194446330 X:93991519-93991541 GGGGCTTAAAACCTGGAGGATGG + Intergenic
1195313808 X:103658577-103658599 AGGGCTAAACAAATGGTGAATGG + Intergenic
1195492166 X:105483618-105483640 GGTGGTAAAGAAATGGAGAAAGG - Intronic
1196224175 X:113146104-113146126 GGGGCTAAGAAGATGGAAGAAGG - Intergenic
1196411417 X:115424157-115424179 GTGGGTAAGGAAATGGAGGAAGG - Intergenic
1201586719 Y:15569208-15569230 CAGGCTGAACAAATGGGGGAAGG + Intergenic