ID: 1179416388

View in Genome Browser
Species Human (GRCh38)
Location 21:41201952-41201974
Sequence AACCACTGGAGGCCTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179416388 Original CRISPR AACCACTGGAGGCCTGGTGT TGG Intronic
900913480 1:5618509-5618531 TACCTCTCGGGGCCTGGTGTGGG + Intergenic
900920540 1:5667640-5667662 AGCCACTGGAGTGCTGGTGAGGG - Intergenic
900920589 1:5667836-5667858 AGCCACTGGAGTGCTGGTGAGGG - Intergenic
900920621 1:5667968-5667990 AGCCACTGGAGTGCTGGTGAGGG - Intergenic
901263203 1:7888991-7889013 AACTCCTCGAGGGCTGGTGTGGG + Intergenic
901776519 1:11563892-11563914 AACTGGTGGAGGCCCGGTGTGGG - Intergenic
903479957 1:23645764-23645786 AGCCTCTGGAGGCCTGGGGTGGG + Intergenic
904047065 1:27615276-27615298 AACGACTGGAGGGCTGAGGTGGG - Intronic
904190691 1:28741217-28741239 AATCACTTGAGGCCAGGAGTTGG - Intronic
905079578 1:35305768-35305790 GATCACTTGAGGCCTGGAGTTGG - Intronic
905993564 1:42361115-42361137 GACCACTTGAGGCCAGGAGTTGG + Intergenic
906229505 1:44149150-44149172 AATCACTTGAGGCCAGGAGTTGG + Intergenic
906557059 1:46722190-46722212 AACCTTGGGAGTCCTGGTGTGGG - Intergenic
907086939 1:51684088-51684110 GATCACTTGAGGCCAGGTGTTGG - Intronic
907212665 1:52837038-52837060 AATCACTTGAGGTCAGGTGTTGG + Intergenic
907400683 1:54223175-54223197 AAGCACTGGGGGCTTGGAGTTGG - Intronic
907458929 1:54593827-54593849 AAACTCTGGAGGCCTGGCCTGGG + Intronic
908191506 1:61708268-61708290 AATCACTTGAGGCCAGGAGTTGG - Intronic
909282083 1:73769852-73769874 AACCACTGCAGGGAGGGTGTGGG + Intergenic
910345507 1:86231809-86231831 AAGCACTGGTGCTCTGGTGTAGG - Intergenic
912529377 1:110309276-110309298 AGCCACTGGAGTCCTGATGAAGG - Intergenic
916326470 1:163565358-163565380 AACCCTGGGAGGCCTGGTCTGGG - Intergenic
917794315 1:178521764-178521786 CTCCAGTGGAGGCCTGGGGTTGG - Intronic
917806191 1:178615937-178615959 GATCACTTGAGGCCTGGAGTTGG - Intergenic
920281506 1:204847043-204847065 CTCCACTGGGGGCCTGGTTTTGG + Intronic
920758560 1:208759439-208759461 GAACACTGCAGGCCTAGTGTGGG - Intergenic
921324076 1:213973432-213973454 AACCAGGAGAGGCCTGGTGGAGG - Intergenic
921429949 1:215053878-215053900 AACCTCTGGAGGCCGGGAGGCGG + Intronic
922724014 1:227914307-227914329 CACCCCTGGAGGCCTGGCCTGGG + Intergenic
922821972 1:228490838-228490860 AGCCATTGGAGTTCTGGTGTGGG + Intronic
923063501 1:230497900-230497922 AATCACTTGAGGCCAGGAGTTGG + Intergenic
923353784 1:233133632-233133654 AATCACTTGAGGCCAGGGGTTGG + Intronic
923388561 1:233490580-233490602 CACCACTGTAGCCCTGGGGTGGG + Intergenic
924679407 1:246216885-246216907 AAGCACTGGAGGCTGTGTGTGGG + Intronic
1063467220 10:6254902-6254924 AACCACTGGAACCCAGGAGTGGG - Intergenic
1063818865 10:9811099-9811121 GATCACTGGAGGCCAGGAGTTGG - Intergenic
1065011304 10:21423323-21423345 AGCTACTGGAGGCCTGAGGTGGG + Intergenic
1065036542 10:21644850-21644872 AATCACTTGAGGCCAGGAGTTGG - Intronic
1065882395 10:30047837-30047859 AACCACTGGAACCATGGTGGTGG + Exonic
1066299477 10:34084223-34084245 ATCCACTGGAGGCAGGGGGTTGG + Intergenic
1068308565 10:55248776-55248798 AATCACTTGAGGCCAGGAGTTGG - Intronic
1068727576 10:60320370-60320392 AATCACTTGAGGCCAGGAGTTGG + Intronic
1070041843 10:72788537-72788559 AATCACTGGAGCCCAGGAGTTGG + Intronic
1072280194 10:93858876-93858898 ACACACTGGAAGCCTGGAGTAGG - Intergenic
1073237447 10:102030140-102030162 GATCACTGGAGCCCAGGTGTTGG - Intronic
1073470821 10:103721066-103721088 AACCCCTGCTGGCCTGGTGATGG + Intronic
1077021033 11:417245-417267 AGCCGCTGCAGGCCTGGAGTCGG - Intronic
1077394716 11:2315292-2315314 AATGGCTGGAGGCCTGGTGAGGG + Intronic
1077704508 11:4471624-4471646 AACCATTTGAGTGCTGGTGTAGG + Intergenic
1078311230 11:10245252-10245274 ACCACATGGAGGCCTGGTGTGGG + Intronic
1080490087 11:32753027-32753049 AATCACTTGAGGCCAGGAGTTGG - Intronic
1080822611 11:35821694-35821716 AATCACTTGAGGCCAGGGGTTGG + Intergenic
1084023529 11:66433131-66433153 AATCACTTGAGGCCAGGAGTTGG + Intergenic
1084444850 11:69197574-69197596 CACCACTGGGGGGCTGGGGTGGG - Intergenic
1084637541 11:70401927-70401949 AATCACTTGAGGCCAGGAGTTGG + Intronic
1085094963 11:73753025-73753047 AATCACTTGAGGCCAGGAGTTGG + Intronic
1085101403 11:73803418-73803440 AATCACTCTAGGCCAGGTGTGGG - Intronic
1085520742 11:77137726-77137748 AGGCCTTGGAGGCCTGGTGTGGG - Intronic
1086038110 11:82441513-82441535 AGCCACTGGGGGCTTGGTGGAGG + Intergenic
1089368032 11:117932777-117932799 AACCTCTGCAGGCCTGGAGTGGG - Intergenic
1089483559 11:118827269-118827291 AATCACTTGAGCCCTGGAGTTGG - Intergenic
1091288020 11:134419577-134419599 AACAACTGGTGGCCTGGAGCCGG - Intergenic
1092287964 12:7140685-7140707 GATCACTGGAGGCCAGGAGTTGG + Intronic
1093278476 12:17159683-17159705 AAGCAAAGGAGGCCTTGTGTTGG - Intergenic
1094195445 12:27744370-27744392 GATCACTTGAGGCCTGGAGTTGG + Intronic
1095396042 12:41763509-41763531 AATCACTTGAGGCCAGGAGTTGG - Intergenic
1096152687 12:49324283-49324305 GATCACTGGAGGCCAGGAGTTGG + Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1100443659 12:94641227-94641249 AACCACTGGATGCCTGGGTAGGG + Intronic
1102465777 12:113130153-113130175 AGCCCCTGGAGGCCTGATGGGGG - Intronic
1102867822 12:116387899-116387921 GATCACTGGAGGCCAGGAGTTGG + Intergenic
1103669635 12:122602337-122602359 AACCACTGGTGCCCTGTTGTTGG - Intronic
1104676857 12:130716991-130717013 GGCCACTGGAGGCTTGGGGTGGG - Intergenic
1106430906 13:29679597-29679619 AATCACTGCATGGCTGGTGTGGG + Intergenic
1107421772 13:40254098-40254120 GACCACTGGAGGCCACTTGTTGG + Intergenic
1108676986 13:52745614-52745636 AATCACTTGAGGCCAGGAGTTGG - Intergenic
1108811808 13:54234794-54234816 AACCACTTGAGCCCAGGAGTTGG - Intergenic
1109309271 13:60672675-60672697 AACCACTGTAGGCCTGGAGCAGG - Intergenic
1112259542 13:97865378-97865400 AAGCACTTGAGGCCAGGAGTTGG - Intergenic
1114876049 14:26719525-26719547 ACCCACTTGAGGCCTGGAATTGG + Intergenic
1115212446 14:30981226-30981248 GACCACTGGAGCCCAGGAGTTGG + Intronic
1115766637 14:36629659-36629681 TACCATTGGAGGCTTGGTGAAGG - Intergenic
1115914898 14:38301513-38301535 AGTCACTGGAGGCCTGCAGTAGG - Intergenic
1116671285 14:47846145-47846167 AGCCACTGGAGCCATGGTGATGG - Intergenic
1118464684 14:66020406-66020428 AACCCCTGGAGGGCAGCTGTTGG - Intergenic
1118667619 14:68087046-68087068 AACCACTGGAACCCAGGTGGTGG + Intronic
1119269251 14:73287597-73287619 GACCACTTGAGGCCAGGAGTTGG - Intronic
1119732588 14:76960328-76960350 TAGGACTGGAGGTCTGGTGTAGG + Intergenic
1121879829 14:97490059-97490081 TTGCACTGGAGGCCTGGAGTGGG - Intergenic
1122070199 14:99201062-99201084 AAATGCTGGAGGCCTGGTGGGGG - Intronic
1122705013 14:103615438-103615460 AGCCACTGGGGGGCTGGGGTGGG - Intronic
1124214368 15:27794240-27794262 GACCACAGGGGCCCTGGTGTGGG + Intronic
1124808054 15:32906246-32906268 AACAAGTGGTGGCCTGGTTTTGG - Intronic
1125285943 15:38092668-38092690 AATCACTTGAAGCCAGGTGTGGG + Intergenic
1127234586 15:57035486-57035508 GATCACTTGAGGCCTGGAGTTGG - Intronic
1127319418 15:57828054-57828076 AACCACAGGAAGTCTGGTTTTGG - Intergenic
1128459605 15:67856608-67856630 AATCACTTGAGGCCAGGAGTTGG + Intergenic
1128525592 15:68410242-68410264 AACCAGTGGAGGCCTGGGGCAGG - Intronic
1129386197 15:75197414-75197436 AGCCATTGGAGGCTTGGTGCTGG - Intronic
1129412741 15:75358955-75358977 AGCCACTGGTGGGCTGCTGTGGG + Intronic
1129651048 15:77490052-77490074 GACCACTTGAGGCCAGGAGTTGG + Intergenic
1131108485 15:89750259-89750281 AAGCACTGGTGGCCTTGTGCGGG + Intronic
1132211962 15:100030461-100030483 GACCACTGGAGCCCTGGTAGGGG - Intronic
1132661369 16:1062934-1062956 GACCACAGGAGGCCTGGCCTGGG - Intergenic
1132893574 16:2216504-2216526 GATCACTGGAGGCCAGGAGTTGG - Intergenic
1134437864 16:14278283-14278305 AACCACTTGAGGTCAGGAGTGGG + Intergenic
1134622835 16:15702625-15702647 AATCACTTGAGGCCAGGAGTTGG - Intronic
1136060246 16:27721449-27721471 AACCAGGAGAGGCCTGGTGAGGG - Intronic
1137254540 16:46764151-46764173 AATCACTTGAGGCCAGGAGTTGG + Intronic
1137578944 16:49621769-49621791 AGACACTGCAGGCCTGGTTTGGG - Intronic
1138588714 16:57987662-57987684 AACTCCTGGAGGACTGGTGGGGG + Intronic
1138673506 16:58634238-58634260 AATCACTTGAGGCCAGGAGTTGG - Intergenic
1138834018 16:60411369-60411391 AATCACTTGAGGCCAGGAGTGGG + Intergenic
1140041119 16:71408874-71408896 AAAGACTGGATGCCTGGGGTTGG - Intergenic
1140607369 16:76555911-76555933 AACCTCTGAAGGCCTTGTCTGGG + Intronic
1141209437 16:81963095-81963117 AACCACTGGGGGCTGGGGGTTGG - Intergenic
1142028323 16:87826046-87826068 AATCACTGGAGCCCGGGTGGCGG + Intergenic
1144798377 17:17908120-17908142 AGCCACTGTAGGTGTGGTGTTGG + Intronic
1144827631 17:18115211-18115233 AACCGCTGGCAGCCTGGTGCAGG + Intronic
1145218541 17:21070088-21070110 AGCCACTGCAGGGCTGGGGTGGG + Intergenic
1145757221 17:27401456-27401478 AATCACTTGAGGCCAGGGGTTGG + Intergenic
1146014367 17:29220654-29220676 AATCACTTGAGGCCAGGAGTTGG + Intergenic
1146193404 17:30790701-30790723 AATCACTGGAAGCCTGGAGGCGG - Intronic
1146891390 17:36508650-36508672 GATCACTGGAGGCCAGGAGTTGG - Intronic
1147625167 17:41895499-41895521 GGCCAGAGGAGGCCTGGTGTAGG - Intronic
1147739790 17:42664944-42664966 GACCACTCGAGGCCAGGAGTTGG - Intronic
1148495638 17:48051908-48051930 GACTGCTGGAGGCCTGGGGTGGG + Intronic
1148590794 17:48815376-48815398 AACCACTGGAGGCCTTCAGAGGG - Intronic
1150644566 17:66969843-66969865 ACCCACTCCAGGCCTGGTGCTGG + Intronic
1151930450 17:77228658-77228680 CAGCACTGGAGGCCTGGCCTGGG - Intergenic
1153810370 18:8747121-8747143 GACCACAAGAGGCATGGTGTGGG - Intronic
1157525476 18:48377091-48377113 ACCTGCAGGAGGCCTGGTGTGGG - Intronic
1157568113 18:48693741-48693763 AACCAATGGAGGGCTGGACTTGG - Intronic
1161446825 19:4323338-4323360 AAGGACAGGAGGCCTGGGGTCGG - Exonic
1162318712 19:9957962-9957984 AATCACTGGAGGCCAGGAGTTGG - Intergenic
1162365272 19:10244877-10244899 AATCACTAGAGGCCAGGAGTTGG + Intergenic
1162639399 19:11996271-11996293 AATCACTTGAGGTCAGGTGTTGG - Intergenic
1162994519 19:14325738-14325760 AACGACAGGAGGACTGGAGTGGG + Intergenic
1164544790 19:29151370-29151392 AGCCACTGGAGGCTTGGTTAGGG - Intergenic
1164660185 19:29958009-29958031 GATCACTTGAGGCCTGGAGTTGG - Intronic
1165166805 19:33862808-33862830 GATCACTGGAGGCCAGGAGTTGG + Intergenic
1165227404 19:34364930-34364952 GATCACTGGAGCCCAGGTGTTGG - Exonic
1165324222 19:35104795-35104817 AGCCACAGAAGGCCTGGTATAGG - Intergenic
1165405027 19:35624673-35624695 AATCACTTGAGGCCAGGAGTTGG - Exonic
1165743367 19:38216647-38216669 GATCACTGGAGGCCAGGAGTTGG - Intronic
1166202416 19:41246774-41246796 GACCAGTTGAGGCCTGGAGTTGG - Intronic
1167722727 19:51189837-51189859 GATCACTGGAGGCCAGGAGTTGG + Intergenic
1167742860 19:51334718-51334740 AACCACTTGAGCCCAGGAGTTGG + Intronic
1167913388 19:52721455-52721477 AATCACTGGAGGTCAGGGGTTGG + Intronic
1168330761 19:55566608-55566630 AACCACTTGAGCCCAGGGGTTGG + Intergenic
925215291 2:2089363-2089385 AAGCACTGAATGCCTGGGGTAGG + Intronic
925599796 2:5596543-5596565 CATCACTGGAGACCAGGTGTGGG + Intergenic
927721823 2:25387972-25387994 AACCCCAGGAGGCCTGTTCTTGG + Intronic
929790194 2:45016642-45016664 AACCCCTGGAAGCAAGGTGTTGG - Intergenic
929850889 2:45589395-45589417 AACCAAGGGAGGCCTGCTGAAGG + Intronic
930760746 2:55032804-55032826 GACCACTTGAGGCCAGGAGTTGG + Intronic
937215583 2:120310989-120311011 GACCACTTGAGGCCAGGAGTTGG - Intergenic
937287691 2:120763522-120763544 ACCCACTGGATGCCTGGTCTTGG - Intronic
938394689 2:130935257-130935279 AACCACTTGAGCCCAGGAGTTGG - Intronic
938653880 2:133411295-133411317 AACATCTGGAGCCCTGGTGTGGG + Intronic
944634656 2:201663492-201663514 AACCACTCGAGGCCTGGAGTTGG + Intronic
945000951 2:205349967-205349989 ACCCACTGGCTGCTTGGTGTTGG - Intronic
945009223 2:205443915-205443937 AATCACTTGAGGCCAGGAGTTGG + Intronic
946538093 2:220653135-220653157 AACAACTGAAGGACTGCTGTAGG - Intergenic
947852046 2:233296222-233296244 GATCACTGGAGGCCAGGAGTTGG + Intergenic
948089431 2:235280267-235280289 AACCACTGAAGGACTGGTATGGG - Intergenic
948512372 2:238477201-238477223 TACCATGGGAGGCCTGGTCTTGG + Intergenic
1170591409 20:17774663-17774685 AACCTCTGGAAGCTTGCTGTGGG + Intergenic
1171041842 20:21771350-21771372 GACCACCGGTGGCCTGGTCTTGG + Intergenic
1172017893 20:31889789-31889811 GATCACTTGAGGCCAGGTGTTGG - Intronic
1172354528 20:34270163-34270185 AATCACTTGAGCCCTGGAGTTGG + Intergenic
1172943654 20:38671878-38671900 AATCACTTGAGGCCAGGAGTTGG + Intergenic
1173430413 20:42982759-42982781 AACCTCAGGAGGGCGGGTGTGGG - Intronic
1173608738 20:44351155-44351177 AATCACTTGAGTCCTGGAGTTGG + Exonic
1175859668 20:62143519-62143541 AACCACCGGTGGCCGGGGGTGGG + Intergenic
1175986783 20:62768037-62768059 GAGCACTGGAGGCCTGTGGTTGG - Intergenic
1176988423 21:15464770-15464792 ACACACTGGGGGCCTGTTGTGGG + Intergenic
1178444924 21:32631052-32631074 ATCTACTGGAGGGCTGGTGCCGG + Exonic
1178827116 21:36026196-36026218 AATCACTTGTGGCCAGGTGTGGG + Intergenic
1179416388 21:41201952-41201974 AACCACTGGAGGCCTGGTGTTGG + Intronic
1179840948 21:44072927-44072949 AACCACAGCAGGCCTGGAGCGGG - Intronic
1181259115 22:21584651-21584673 AATCACTTGAGGCCAGGAGTTGG - Intronic
1183683069 22:39345774-39345796 AATCACTTGAGGCCAGGAGTTGG - Intergenic
1183849710 22:40574653-40574675 AATCTCTTGAGGCCAGGTGTTGG - Intronic
1184407998 22:44311130-44311152 TCCCACTGGAGCCCTGGAGTTGG - Intronic
1184776004 22:46623251-46623273 AAGAAGTGGAGGCCTGGTGGGGG - Intronic
949589504 3:5479245-5479267 AACCACTGGAGAACTGGTAAAGG - Intergenic
949782103 3:7701246-7701268 GGCCACTGGAGGCCTGGTTTTGG + Intronic
950636884 3:14321665-14321687 AACCACTTGAGCCCAGGAGTTGG + Intergenic
951579630 3:24148481-24148503 GATCACTTGAGGCCAGGTGTTGG - Intronic
955711209 3:61780952-61780974 TCCCTCTGGAGGCCTGTTGTAGG - Intronic
961466529 3:127085143-127085165 AACCACTGGAGGTGTTGCGTGGG + Intergenic
963603006 3:147393387-147393409 AAGGACTGGAGGCCGGGTGTTGG - Intronic
967032370 3:185619953-185619975 AACCACTTGAGGCCAGGCGTTGG - Intronic
967517803 3:190391006-190391028 GATCACTTGAGGCCTGGAGTTGG - Intronic
968234082 3:197021529-197021551 CACCTCTGGAGGCCTGGCTTGGG + Intronic
968871689 4:3245830-3245852 GACACCTGGAGGCCTGGTGTAGG - Intronic
970198665 4:13578632-13578654 AATCACTGGAGCCCAGGAGTTGG - Intronic
972654462 4:41051260-41051282 AAACACTGGAGACCTTCTGTGGG + Intronic
972968142 4:44538227-44538249 AATCACTTGAGGCCGGGGGTTGG - Intergenic
973642337 4:52915868-52915890 AACAACTGGAGGCCAGGGCTGGG + Intronic
974899444 4:67979298-67979320 AACCACTTGAGGTCAGGAGTTGG - Intergenic
976173896 4:82333268-82333290 GACCACTTGAGGCCAGGAGTTGG + Intergenic
978374067 4:108056923-108056945 AACCACTGCAGGCCAAGTGTGGG + Intronic
980911788 4:139000603-139000625 GATCACTGGAGGCCAGGAGTTGG + Intergenic
982513736 4:156318081-156318103 AGCCAATGGAGGCCTGTTGCTGG + Intergenic
982765896 4:159347997-159348019 AATCACTCGAGGCCAGGAGTTGG + Intronic
983047763 4:163007105-163007127 CACCACTGGATCCCTGGTTTTGG - Intergenic
984964582 4:185128727-185128749 AGCGACTGGTGGCCTGGTGGGGG + Intergenic
985489432 5:170844-170866 CACCCCTGGAGCCCTGGTGTTGG + Intronic
986066231 5:4236806-4236828 GACCACTTGAGGCCAGGAGTTGG - Intergenic
986352118 5:6890081-6890103 AATCACTTGAGGCCAGGAGTTGG + Intergenic
987040932 5:14061497-14061519 AATCACTTGAGGCCAGGAGTTGG + Intergenic
988824211 5:34918079-34918101 AGCCACTTGAGCCCAGGTGTTGG + Intronic
990428686 5:55713163-55713185 AATCACTTGAGGCCAGGAGTTGG + Intronic
990452959 5:55953765-55953787 AATCGCTTGAGGCCAGGTGTTGG + Intronic
991414213 5:66375780-66375802 AACCCCTGGAGGCCTAGTGAGGG + Intergenic
993598084 5:89884712-89884734 GACCACTGGAGGCCACCTGTAGG - Intergenic
996974350 5:129412616-129412638 AACCACTAAAGGCCTGGTTTGGG + Intergenic
997329311 5:133047579-133047601 CAGCACTAGTGGCCTGGTGTGGG + Intergenic
998072132 5:139206140-139206162 AGCCACTGCAGGGCTGTTGTAGG + Intronic
998206129 5:140157828-140157850 AATCACTTGAGGCCAGGAGTTGG + Intergenic
999745330 5:154587535-154587557 CACCATTGGAGGCCTGGTGTTGG + Intergenic
1003890299 6:10558008-10558030 AGCCTGTGGAGGCCTGGAGTAGG - Intronic
1005406949 6:25499279-25499301 TACCACTGGCAGCCTTGTGTTGG + Intronic
1005468301 6:26136942-26136964 GATCACTTGAGGCCTGGTGTTGG - Intronic
1007449398 6:41931607-41931629 GAACACAGCAGGCCTGGTGTGGG + Intronic
1008594214 6:53025052-53025074 AATCACTTGAGGCCAGGAGTTGG - Intronic
1009265175 6:61545222-61545244 GACCACTTGAGGCCAGGAGTTGG + Intergenic
1011665667 6:89630475-89630497 AACCACTGGAGGGGAGCTGTCGG - Exonic
1015461288 6:133494614-133494636 AATCACTTGAGGCCAGGAGTTGG + Intronic
1017178546 6:151527644-151527666 CACCACTGGAAGCTTGGTGGGGG + Intronic
1017410659 6:154164449-154164471 AGCCCCAGGATGCCTGGTGTAGG - Intronic
1017825601 6:158079590-158079612 CATCACTGGAGGCCAGGAGTTGG - Intronic
1018694779 6:166382884-166382906 GACCACTCGGGGTCTGGTGTCGG - Exonic
1019666478 7:2254499-2254521 AACACCTGGAGCCCTGGTCTGGG - Exonic
1020937685 7:14487832-14487854 AATCACTTGAGGCCAGGAGTTGG - Intronic
1022324434 7:29318239-29318261 AACAAGTGGAGGCCAGGAGTTGG - Intronic
1026017899 7:66684984-66685006 AATCACTTGAGGCCAGGGGTTGG - Intronic
1026025988 7:66743850-66743872 AATCACTTGAGGCCAGGGGTTGG - Intronic
1027243100 7:76346124-76346146 GAGCACTGGATGCCTGGGGTCGG - Intronic
1027382412 7:77624911-77624933 AATCACTTGAGGCCAGGAGTTGG + Intronic
1027528163 7:79297163-79297185 AAACACTGTAGGCCAGGTGGTGG - Intronic
1029580569 7:101434338-101434360 GACCACTGGAGACCAGGAGTTGG - Intronic
1033240061 7:139670980-139671002 AATCACTTGAGGCCAGGAGTTGG - Intronic
1036426350 8:8648476-8648498 CACCACTGGAGGACTAGGGTAGG - Intergenic
1037118226 8:15251668-15251690 AACCTCTGGACTCCTGATGTGGG - Intergenic
1037764802 8:21766060-21766082 AACCACTGGAGGCATTGAGGCGG - Intronic
1038719666 8:30023081-30023103 AATCACTTGAGGCCAGGAGTTGG + Intergenic
1038755007 8:30332562-30332584 AATCACTTGAGGCCAGGAGTTGG - Intergenic
1040888569 8:52291293-52291315 AGCCACTGTAGGCATCGTGTGGG - Intronic
1041203466 8:55473990-55474012 GATCACTGGAGCCCAGGTGTTGG - Intronic
1041734878 8:61099285-61099307 AGCCACTGAAGGCCTGGGATGGG + Intronic
1042256922 8:66814646-66814668 AAAGACTGGAGGCCTCATGTGGG - Intronic
1044993688 8:97818785-97818807 AATCACTTGAGCCCTGGTGGTGG - Intronic
1045016581 8:98006003-98006025 AGACACTGGAGGCCTGGTGCAGG - Intronic
1045555265 8:103209080-103209102 AACATCTGGAGGCTGGGTGTGGG + Intronic
1046161578 8:110373949-110373971 ACACACTGGGGGCCTGTTGTGGG - Intergenic
1046641125 8:116733016-116733038 AAGTACTGGAGGCCTGGATTTGG - Intronic
1046845903 8:118915803-118915825 AATCAATGTAGGCCTAGTGTGGG + Intergenic
1047035722 8:120936811-120936833 AACCACTCGCAGCCTGGTTTGGG + Intergenic
1048370703 8:133773859-133773881 CAACACTGGAGGCCTGGTGGGGG + Intergenic
1049530018 8:143149377-143149399 ACTCACTGGAGGCTGGGTGTGGG + Intergenic
1051809874 9:21036774-21036796 AACGAATGGAGGCCTGGGGATGG - Intergenic
1052051085 9:23850396-23850418 ATCCACTTGAGGTCTGGGGTTGG + Intergenic
1053062455 9:35043034-35043056 AACCACAGGATGGCTGGGGTGGG - Exonic
1053481014 9:38416151-38416173 AGCCACTGGAGCACTGGTTTGGG - Intronic
1054958822 9:70944183-70944205 AATCACTGGAGGGCTGGAGGTGG + Intronic
1056248854 9:84727731-84727753 AACCACTGAAGCGCTGGTTTGGG - Exonic
1056327999 9:85497002-85497024 AATCACTTGAGGCCAGGAGTTGG + Intergenic
1057051013 9:91924242-91924264 GACCACAGGATGCCTGATGTTGG - Intronic
1057168935 9:92949296-92949318 ACCCACTGGTGGCTTGCTGTTGG + Intronic
1057793074 9:98136907-98136929 AATCACTTGAGGCCAGGAGTTGG - Intronic
1059349188 9:113652320-113652342 GATCACTGGAGGCCAGGAGTTGG + Intergenic
1060329385 9:122652020-122652042 GACCACTTGAGGCCAGGAGTTGG - Intergenic
1060522336 9:124300861-124300883 AACCCCTTGAGGCCTGGCCTAGG - Intronic
1061376405 9:130227385-130227407 AACCAGTGGATGCCTGCTGTTGG + Intronic
1185870298 X:3659042-3659064 GATCACTTGAGGCCAGGTGTTGG + Intronic
1185876160 X:3703959-3703981 AGCCATTAGAGGCCGGGTGTGGG - Intronic
1186090328 X:6040022-6040044 AATCACTGGAGCCCTTGAGTTGG - Intronic
1186488223 X:9950525-9950547 GATCACTGGAGCCCTGGAGTTGG - Intergenic
1189912560 X:45825711-45825733 ACTCACTGGAAGCGTGGTGTGGG - Intergenic
1190659777 X:52643509-52643531 AAAAACTGGAGGCCAGGTGCTGG + Intergenic
1191662759 X:63667827-63667849 AACCTCTGGAGGCCTGATACTGG + Intronic
1193392725 X:80948569-80948591 TAACTCTGGAGGCCTGGTATTGG + Intergenic
1195355839 X:104039487-104039509 AATCACTGGAGTCCAGGAGTTGG + Intergenic
1197788437 X:130224301-130224323 AACCACTGGTGCCCTGATCTTGG + Intronic
1200042093 X:153378243-153378265 TACCACTGGAAGCCTCCTGTGGG - Intergenic
1200413192 Y:2881777-2881799 AACCACTGGTTGCCTGCTGGTGG + Intronic