ID: 1179416513

View in Genome Browser
Species Human (GRCh38)
Location 21:41202884-41202906
Sequence ATTTTGTCCTGCCTGATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179416513 Original CRISPR ATTTTGTCCTGCCTGATCAC TGG (reversed) Intronic
907180201 1:52562817-52562839 ATTTTCTCCTGCCTGAGAATAGG - Intergenic
907981505 1:59486359-59486381 ATTTATTTCTGCCTGCTCACAGG - Intronic
908051380 1:60235277-60235299 TTTCTGTCCTGCCTGATCCTTGG - Intergenic
908666685 1:66499777-66499799 AATTTGTCTTGCCTGTTCATGGG - Intergenic
908987153 1:70038363-70038385 ATCCTGTCTTGCCTGATCAAAGG - Exonic
909327709 1:74372801-74372823 TTTTGGTCCTGCCTGACAACTGG - Intronic
911124800 1:94331242-94331264 ATTTTGTCCTGCCTTTTCTCTGG + Intergenic
911249858 1:95563058-95563080 ACATTGTGCTGCCTGATGACAGG - Intergenic
915215680 1:154339263-154339285 GTTTAGTCCTGCCTCCTCACTGG + Intronic
915754689 1:158248602-158248624 ATTTTGTACTCCCTGGACACAGG - Intergenic
916584752 1:166140762-166140784 TTTGTATCCTCCCTGATCACTGG + Intronic
918252702 1:182717770-182717792 ATTTTGTCTGTCCTGGTCACTGG + Intergenic
920709235 1:208279227-208279249 GTTCAGTCCTGCCTGGTCACAGG - Intergenic
921832917 1:219748372-219748394 ATTTTGTCCTCTCTGTTCTCTGG - Intronic
1063521038 10:6741181-6741203 TTTTTATCTTGCCTGAACACAGG - Intergenic
1066060624 10:31720712-31720734 CTTTTGTCCTTCCTGTTGACTGG + Intergenic
1066267473 10:33790423-33790445 ATTTTGACCTGCATATTCACTGG + Intergenic
1066642241 10:37566320-37566342 ACTCTGTCCTGCCTGCCCACAGG - Intergenic
1075639438 10:124054204-124054226 ATTTCATCCTTCCTGATGACTGG + Intronic
1078935864 11:15949507-15949529 ATTGTGTCATGCCTTTTCACAGG + Intergenic
1080315756 11:30946243-30946265 ACGTTATCCTGCCTGATCTCTGG + Intronic
1080342407 11:31281242-31281264 CTTTTTTCTTGCCTTATCACAGG + Intronic
1080900416 11:36484645-36484667 ATTTTCTCCTGACTGACCATGGG - Intergenic
1083282504 11:61635873-61635895 TCTTTGTTCTGCCTCATCACTGG - Intergenic
1085385675 11:76156954-76156976 AGTTTGTCCTGCTTGATCCAAGG + Intergenic
1087947005 11:104174791-104174813 CTTTTGTTCTTCCTCATCACTGG + Intergenic
1090189657 11:124759786-124759808 ATTGTCTTCTGCCTTATCACTGG - Intronic
1091513477 12:1153795-1153817 ATTTTGGCCTACATAATCACAGG + Intronic
1100267330 12:92990085-92990107 ATTTTGTTCTGATTGATCAGTGG + Intergenic
1102422383 12:112814236-112814258 AGTTCTTCCTGCTTGATCACAGG + Intronic
1103921068 12:124399406-124399428 CTTTCTTCCTGCCTGATCTCTGG - Intronic
1104080278 12:125424312-125424334 AGCTTGTCCTGCCTGTTTACAGG + Intronic
1106746035 13:32708254-32708276 ATTTTCTTCTGCCCTATCACTGG + Intronic
1109082200 13:57918969-57918991 AATTTTTCATGCCTGATCATAGG + Intergenic
1110411920 13:75214226-75214248 ATTCTGTCCTGCTTGGTCCCTGG + Intergenic
1111982459 13:95031272-95031294 TTTTAGTCCTGCCTAACCACTGG - Intronic
1115925640 14:38430420-38430442 ATTTTTTCCTGACTGACTACAGG - Intergenic
1119135376 14:72213468-72213490 ATTTTGTCCAGATTGATCACAGG - Intronic
1120735245 14:88045383-88045405 ATTATGTCCTCCCTGAGCTCTGG + Intergenic
1122538948 14:102485999-102486021 ATTCTGTCCTTCCTGAGCAGGGG - Intronic
1126294727 15:47126631-47126653 ATATTCTCCTGAATGATCACTGG - Intergenic
1126758452 15:51947280-51947302 ATTTGGTCTTACCTCATCACTGG + Exonic
1128117500 15:65119952-65119974 ATTTTGTCCTGTCTGCCCAGGGG - Exonic
1133009251 16:2901263-2901285 TTTTTGTCCTCACTGCTCACTGG - Intergenic
1134468763 16:14502911-14502933 AATTTTTCCTCCCTGATCTCTGG - Intronic
1134818738 16:17228390-17228412 ATTGTGACTTGCCTGGTCACAGG + Intronic
1135240684 16:20805091-20805113 ATTGTGTCCTCCCTGATTCCTGG - Intronic
1135358373 16:21789956-21789978 AATTTGTCCTGTCTGATGACAGG + Intergenic
1135456876 16:22606081-22606103 AATTTGTCCTGTCTGATGACAGG + Intergenic
1136506343 16:30706097-30706119 ATTTAGTCCTGTCTGGTCTCTGG + Intronic
1141393686 16:83685818-83685840 CTTTCGTCCTGCCTGTGCACAGG + Intronic
1142905217 17:3036795-3036817 CTCTTGTCCTGCCTTGTCACGGG - Exonic
1144425484 17:15137386-15137408 ATTTAGTCTTGTCTCATCACTGG + Intergenic
1149348396 17:55762263-55762285 ATTTTGTTCTGGTTGATCAGTGG + Intronic
1151638576 17:75371377-75371399 ATGTTGTCCTGCCTGAGTTCAGG - Intronic
1152564688 17:81095037-81095059 CTTTTGTCTTCTCTGATCACGGG + Intronic
1155241030 18:23863742-23863764 ATTTTGTTCTGTCTAATCAGAGG + Intronic
1155681662 18:28494192-28494214 ATTTTGTCCAGACAGATCAGTGG - Intergenic
1163084823 19:14971736-14971758 ATTGTCTCCAGCCTGGTCACAGG - Exonic
1166969155 19:46551371-46551393 ATTTTGTCCTTCCTGCTCTTTGG + Intronic
927016714 2:18971007-18971029 ATTTTTTCCTGCCTGATAGAGGG + Intergenic
927175737 2:20406001-20406023 ATTCTGTTCTGCCTCCTCACTGG - Intergenic
930068138 2:47343481-47343503 ACTTGATCCTGCCTGCTCACAGG - Intergenic
931036536 2:58250628-58250650 ATTTTCTCCTGCCAGAGCAGAGG + Intergenic
931732235 2:65163488-65163510 ATTTTGGGCTTCCTGAACACTGG + Intergenic
932318052 2:70799268-70799290 ATTTTTTCCTGCTAGATCTCTGG + Intergenic
935419015 2:102847430-102847452 ATTTTGTCCTCTCTGATTAAAGG - Intergenic
935621078 2:105130113-105130135 AATTCTTCCTGCCTGGTCACTGG + Intergenic
935726506 2:106028559-106028581 ATTTTCTCCAGCCAGAGCACTGG - Intergenic
937543786 2:122989910-122989932 ATCTTATTCTTCCTGATCACAGG + Intergenic
941481696 2:166023713-166023735 ATGTTGACCAGACTGATCACAGG - Intronic
941826708 2:169906703-169906725 ATCTTGTCCAGCATGATTACTGG - Intronic
943703367 2:191011001-191011023 ATCTTGTCCTGCCAGACCTCTGG + Intronic
944016759 2:195049724-195049746 ATTTTGTAATGGCTGAACACAGG - Intergenic
945412253 2:209524722-209524744 TTTCTGTCTTGCCTGAACACTGG + Intronic
946313363 2:218895110-218895132 GATTTGTGCTGGCTGATCACTGG - Intronic
946450925 2:219778282-219778304 GTTTTCTCCTCCCTGATCCCAGG - Intergenic
1170363561 20:15574801-15574823 ATTTGCTCATGCCTGATAACTGG - Intronic
1176882299 21:14211780-14211802 ATTTTGAACTGTCTGATCTCTGG + Intergenic
1178497899 21:33102285-33102307 ATTATGTCCTGCCAGAGCCCTGG - Intergenic
1179416513 21:41202884-41202906 ATTTTGTCCTGCCTGATCACTGG - Intronic
1179463152 21:41551192-41551214 ATTTTGTTCTGATTGATCAGTGG + Intergenic
1180203799 21:46244481-46244503 ATCCTGTCCTGCCTGCCCACAGG - Intronic
1183920080 22:41159083-41159105 ATTTTCTCCTGCCCAATCAATGG + Intronic
1184027780 22:41870694-41870716 ATTTTGTACAGCCTGAATACCGG - Intronic
1184908896 22:47512413-47512435 ACTTTGTTCTGACTGATCAGTGG + Intergenic
950363996 3:12470212-12470234 ATTTTGTCTTGGCTGATGGCTGG + Intergenic
951835610 3:26980185-26980207 ATTTTGTTCTGATTGATCAGTGG + Intergenic
955160850 3:56464311-56464333 CTTTTCTCCTGGCAGATCACTGG - Intronic
956920811 3:73927224-73927246 AATATGTTTTGCCTGATCACTGG - Intergenic
963584986 3:147175736-147175758 ACTTGGTCATGCCTGATCTCAGG - Intergenic
965670784 3:171145584-171145606 ATTTTGTCCCACCTGTTCAGGGG + Intronic
965684660 3:171289452-171289474 ATTTTTTCCTGTCTCATCTCTGG - Intronic
966903479 3:184504868-184504890 ATTTTGTCCTGCTTGTTTCCAGG + Intronic
968638549 4:1696952-1696974 ATGTTGGCCAGCCTGATCTCAGG - Intronic
975840182 4:78465630-78465652 CTTTTCTCCTGCCTGTTCAATGG - Intronic
979178983 4:117701766-117701788 TTTTTGTCTTTCCTAATCACAGG + Intergenic
982511785 4:156291394-156291416 ATCTTGTCCTGCCTGTGCATTGG - Intergenic
985199214 4:187466980-187467002 ATATTGTGCTGCCTGAAAACCGG + Intergenic
992083180 5:73254277-73254299 ATGGTCTCCTGCCTTATCACTGG + Intergenic
998012441 5:138706060-138706082 ATATTGTCCTCCATGAACACAGG - Intronic
998253461 5:140567746-140567768 ATTCTGTACTGCCTCATCTCAGG + Exonic
999000160 5:147912068-147912090 ATTCTGCACTCCCTGATCACGGG - Intergenic
999070433 5:148738377-148738399 ATTATCTCTTGCCTGACCACTGG + Intergenic
1001298818 5:170518787-170518809 ATTCTGTGCTAACTGATCACAGG + Intronic
1004309401 6:14531206-14531228 ATTTTGGCCTCCCAAATCACTGG - Intergenic
1004760777 6:18663762-18663784 TTTTTTTCCTCCCTGCTCACTGG + Intergenic
1005864708 6:29928642-29928664 AGTGTGTCCTGCCTGGTTACTGG + Intergenic
1006253522 6:32811125-32811147 ATTGTGTCCAGCCTGTTCAATGG - Intergenic
1009787607 6:68359049-68359071 ATTGTGTTCTGTCTCATCACAGG - Intergenic
1010215400 6:73396729-73396751 ATTTTTTCCTGCCCCATCCCAGG + Intronic
1013385921 6:109630639-109630661 ATGTTGTCCAGGCTGATCTCAGG - Intronic
1014294540 6:119602711-119602733 ATTTTTTCCTGAGTAATCACTGG + Intergenic
1016790768 6:148064844-148064866 ATTTTGGCCTGCCAGCTCAGGGG - Intergenic
1020708077 7:11570724-11570746 ATTTTTTCCTGCATGTTCAATGG - Intronic
1022878691 7:34563715-34563737 ATTTTCTCATTCCTGTTCACTGG + Intergenic
1023298823 7:38746115-38746137 TATTTGTACTGCCAGATCACAGG + Intronic
1023921573 7:44634145-44634167 AGTTTGTGCTGGCTGTTCACTGG + Intronic
1024030332 7:45455217-45455239 ATTTTGTTCTGACTGATCAGTGG - Intergenic
1026687551 7:72524340-72524362 ATTTTTTCCAGCCTGATTAATGG - Intergenic
1033850696 7:145491084-145491106 ATTTTCTCCTGAATGATCTCAGG + Intergenic
1035610724 8:962371-962393 CTTTTGTTCTGCCTGATCTTGGG + Intergenic
1040116471 8:43626374-43626396 TTTTTTTCCTGCTTGAACACTGG - Intergenic
1041141275 8:54821861-54821883 TTTTTTTCCTGCTTGAACACTGG - Intergenic
1041835291 8:62205418-62205440 GTTTTCTCCTGACTGACCACTGG + Intergenic
1043326531 8:79059211-79059233 ATTTTGTCCTGCCTGGTGCCAGG + Intergenic
1043698086 8:83246865-83246887 ATTTTGTCCTACCTTTTCTCTGG + Intergenic
1043718647 8:83515302-83515324 ATTTTGCACTTCCTGAACACAGG - Intergenic
1045746835 8:105432248-105432270 TTTTCCTCCTGCTTGATCACTGG - Intronic
1047399112 8:124531202-124531224 ATTTTCTCCTGCCAAATGACAGG - Intronic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1051586532 9:18732597-18732619 ATTTCTTCCTGCCTTATCCCAGG - Intronic
1059632836 9:116142875-116142897 ATTTTCTCCTTTCTGATGACTGG + Intergenic
1060079091 9:120624669-120624691 ATGTTGGCCAGGCTGATCACTGG - Intronic
1188006791 X:25021117-25021139 ATTCATTCCTGCCGGATCACTGG - Intergenic
1189768574 X:44397786-44397808 ATTTTGTCCAGATTGATCAGAGG - Intergenic
1190361089 X:49649116-49649138 TTTTTGTCCTGCTTGATCTTGGG + Intergenic
1190477184 X:50839927-50839949 CTCTAGTCCTGCCTGATCCCTGG - Intergenic
1197635796 X:128913718-128913740 TTTTTGGCCTGCCTGGGCACTGG - Intergenic
1201316056 Y:12646827-12646849 ACTTTCTCCTGAATGATCACTGG + Intergenic