ID: 1179418526

View in Genome Browser
Species Human (GRCh38)
Location 21:41217454-41217476
Sequence GGAAGTTGCTTGGCTAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179418526_1179418532 29 Left 1179418526 21:41217454-41217476 CCCGTTTTAGCCAAGCAACTTCC 0: 1
1: 0
2: 2
3: 5
4: 110
Right 1179418532 21:41217506-41217528 AATCCCCAACACAGAGACAGTGG 0: 1
1: 0
2: 2
3: 27
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179418526 Original CRISPR GGAAGTTGCTTGGCTAAAAC GGG (reversed) Intronic
902171455 1:14614921-14614943 GCAAGTTGCTTTACTAAAATAGG + Intronic
909131369 1:71741517-71741539 GGTAGGTGCTTGGCAAATACTGG - Intronic
912712782 1:111961536-111961558 GGAAGGAGCTTGGCAAAAGCTGG - Intronic
912766356 1:112415437-112415459 GGAAATTGGTTATCTAAAACTGG + Intronic
915496031 1:156283144-156283166 GAAAGAGGCTTGGCTCAAACGGG - Intronic
918779490 1:188679729-188679751 TAAAATTGCTTGGCAAAAACTGG + Intergenic
919281036 1:195488941-195488963 AGAAGTTGACTGTCTAAAACTGG - Intergenic
919526689 1:198662110-198662132 GGAAGTGCCTTGCCTAAATCTGG - Intronic
922544412 1:226445159-226445181 GGAAGTGGCTTGGCTAGCAAAGG + Intergenic
1063354494 10:5385410-5385432 GGAAGAGGCTTGGCTAGCACAGG - Intergenic
1065031892 10:21594671-21594693 AGGAGTTTCTGGGCTAAAACCGG - Intronic
1066609158 10:37219039-37219061 GGAAATTGCCATGCTAAAACTGG + Exonic
1071016471 10:81002687-81002709 GGTAGTGGCTTGGCTTAAAATGG + Intergenic
1075455158 10:122580277-122580299 TAAAGATGCTTGGCTAAAAGTGG + Intronic
1076490837 10:130860235-130860257 GGAACTGGCTTGGCTAAGCCTGG - Intergenic
1082105328 11:48215328-48215350 GTAAGGAGCTTGGCTAAAACTGG - Intergenic
1083597828 11:63927621-63927643 GTAAGTTGCTGGGGTAAGACAGG - Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085450212 11:76627361-76627383 GGAAGTTGCTCAGCTAGAAGAGG + Intergenic
1086538434 11:87878596-87878618 GGAAATTGCTTTTTTAAAACTGG - Intergenic
1090335343 11:125958895-125958917 GTAACTTGATTGGCTAACACAGG + Exonic
1091679846 12:2519324-2519346 AGAAGGTGCTTTGCCAAAACTGG - Intronic
1098637303 12:72800290-72800312 GGACTGTACTTGGCTAAAACAGG - Intergenic
1099889921 12:88579044-88579066 GGACATTGCCTGGCTAAAAGAGG - Intronic
1102783249 12:115583794-115583816 GGAAGTTGCTGGGCTTAAACAGG - Intergenic
1104810179 12:131615783-131615805 GGAAGAGGCTTGGCTAGCACAGG - Intergenic
1105370305 13:19796243-19796265 GCAAGGTTCTTTGCTAAAACTGG + Intergenic
1109010290 13:56932347-56932369 GGAGGGAGCTTGGCTCAAACAGG + Intergenic
1110785192 13:79516104-79516126 GGAAGTATCTTGGGAAAAACAGG + Intronic
1111188663 13:84778724-84778746 GCAAGTTGCTTGGGTAGAAGTGG + Intergenic
1114906162 14:27129466-27129488 GTAAATTGCTTGGGTAAAATAGG - Intergenic
1118386589 14:65260658-65260680 TGAAGGTGCTTGGTTAGAACAGG + Intergenic
1119762584 14:77162087-77162109 GGAAGAGGCTTGGCAAAGACCGG - Intronic
1121189215 14:92010084-92010106 GGAAATTTCTTGGCTAAGGCAGG - Intronic
1124805882 15:32882304-32882326 GGAAGTTACTTTGCTACTACTGG - Intronic
1125608056 15:40953356-40953378 CGAAGTTGATTGGCCAAAAGGGG + Exonic
1130432230 15:83860080-83860102 GGGAGTAGCTTGGCTACTACAGG + Intronic
1131441366 15:92462006-92462028 GGAAGTTTCTTGGCCCAGACAGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1139451002 16:67028309-67028331 GGAAGTTGTTTAGCCCAAACTGG - Intergenic
1139917750 16:70438820-70438842 GGAAGTTGCCGGGCTGGAACGGG + Intronic
1140187677 16:72789066-72789088 GGAAGTTGTTTGGCTGAAAGGGG - Intronic
1140187693 16:72789167-72789189 GGAAGTTGTTTGGCTGAAAGGGG - Intronic
1140187710 16:72789267-72789289 GGAAGTTGTTTGGCTGGAAGGGG - Intronic
1140955496 16:79861320-79861342 GGAAGATGTTTGGCTAACAATGG - Intergenic
1150131577 17:62672092-62672114 GGAAGTTGTTGGGCTCAAAGGGG - Exonic
1151877641 17:76876294-76876316 GCAAATTGCTTGGCTGAATCAGG + Intronic
1154482713 18:14851568-14851590 GGAAATTGCCATGCTAAAACTGG + Exonic
1162547603 19:11339776-11339798 AGATGTTGCTTGGCTAGGACGGG - Intronic
1164187545 19:22883915-22883937 GGAAGTTGCTTTTCTAATTCTGG - Intergenic
1167024907 19:46908653-46908675 GGAAGTACTTTGGCTAAAAGCGG + Intergenic
926176099 2:10593708-10593730 AGAAGTTGCTTGGCTGAGGCTGG + Intronic
926778967 2:16449535-16449557 GGAGGCTGCTTGGCTGAAGCTGG - Intergenic
926873971 2:17454534-17454556 TGAAGTTTCCTGGGTAAAACAGG + Intergenic
929149087 2:38731792-38731814 GGAAGTTGCCCGTGTAAAACTGG - Exonic
929897044 2:45969626-45969648 GGGGGTTGCTTGGCACAAACAGG - Intronic
930601311 2:53446508-53446530 GGAAATTGCCTGGCTAGAATTGG - Intergenic
932733224 2:74235128-74235150 GGGAGTTTCTAGGCCAAAACAGG + Exonic
940323041 2:152397564-152397586 GGGAGTTTCCTGGCTAAGACAGG + Intronic
1171566398 20:26194724-26194746 AGAAGATACTTGGCCAAAACTGG + Intergenic
1172460655 20:35115831-35115853 TGAAGTTGGTTGGGTCAAACAGG + Exonic
1176797888 21:13385079-13385101 GGAAATTGCCATGCTAAAACTGG - Intergenic
1177163488 21:17574524-17574546 ATATGTTGCATGGCTAAAACAGG - Intronic
1177354221 21:19986551-19986573 GTTAGTTGCTAGGCCAAAACTGG - Intergenic
1177844748 21:26275954-26275976 TGAAGTTGCTTGGAGAAAATGGG + Intergenic
1179158958 21:38876216-38876238 GCAAGTTGCTCGGTGAAAACAGG + Intergenic
1179418526 21:41217454-41217476 GGAAGTTGCTTGGCTAAAACGGG - Intronic
1181473936 22:23157166-23157188 GGAAGTTGTTTCGCTAAAGCAGG + Intronic
1183136469 22:35893805-35893827 GGAACCTACTTGGCTAACACAGG - Intronic
1183682903 22:39344360-39344382 GGAGGGTTCTTTGCTAAAACTGG + Intergenic
1184664924 22:45983259-45983281 GGAACTTCCAGGGCTAAAACTGG - Intergenic
1185227286 22:49660260-49660282 GGCAGTCGTTTGACTAAAACAGG + Intergenic
951073504 3:18361477-18361499 GGAAGATGCTTGGTTCAGACTGG - Intronic
952137251 3:30437170-30437192 GGGAGTTGTTTGGCTGAAACTGG - Intergenic
952274834 3:31866966-31866988 GGAATATGATTGGCTAATACAGG - Intronic
952752828 3:36839316-36839338 GAAAGCTGCTTTTCTAAAACAGG + Intronic
955114967 3:55988985-55989007 GGAAGTTTCTTGGGAAAAAAAGG - Intronic
956999970 3:74874196-74874218 GGAAGTTCCTTGGCAGAAAAAGG - Intergenic
959333060 3:105030786-105030808 GGAGGTTTCTTGGGTAAACCAGG - Intergenic
961021640 3:123512500-123512522 GGAAGGTGGTGGGCTAACACAGG + Intronic
962036683 3:131659324-131659346 GGAAGATACTTGGGGAAAACTGG - Intronic
968830283 4:2930059-2930081 GCAAGTTCCTTGTCTAAATCTGG + Exonic
970152476 4:13104177-13104199 GGGAGTAGCTTGGCTAATAGGGG - Intergenic
975651254 4:76595831-76595853 GAAACTTGCTTATCTAAAACAGG - Intronic
975822135 4:78282249-78282271 GTAATTTGCTTGGCTGAAAAAGG + Intronic
978926182 4:114248437-114248459 GAAAGGTTCTTTGCTAAAACTGG - Intergenic
981699945 4:147597358-147597380 GGAAAGGGCCTGGCTAAAACTGG + Intergenic
983036276 4:162870263-162870285 CGAAGGTGCTTGGGTAATACTGG + Intergenic
985433146 4:189900831-189900853 TGAAGCTGCATGGCTAAAAATGG - Intergenic
989406183 5:41063796-41063818 GGAAGTTTCTTGGATGAGACTGG - Intronic
993809715 5:92460674-92460696 GACACTGGCTTGGCTAAAACTGG - Intergenic
997896893 5:137726967-137726989 GGAAGGTGCTGTGCTAAAAGAGG - Intronic
998061111 5:139119448-139119470 GGAACTTGCCTGGTTAAAAGTGG + Intronic
1000797419 5:165682386-165682408 GGAAGTTGCATGGCCAGAAGAGG + Intergenic
1001252431 5:170157083-170157105 TGGAGTTGCTTGGCTAAATTAGG + Intergenic
1001328624 5:170746739-170746761 TGCAGTCGCTTGGCTGAAACAGG + Intergenic
1005025719 6:21461127-21461149 GGAAGTTGCCCGGCTAGAAGAGG + Intergenic
1005181749 6:23114548-23114570 GGAAGTTGCTTCTCTAACATTGG + Intergenic
1008495861 6:52133538-52133560 GGCAGCTGCTTGGCTAAATGTGG - Intergenic
1008679705 6:53859066-53859088 GGAAGATTCTTGGCTAAGAGAGG + Intronic
1009631231 6:66203196-66203218 GGAACTTGCTTGGGCAAACCAGG - Intergenic
1011574544 6:88781239-88781261 GCATTTTGCTTGCCTAAAACAGG + Intronic
1021709588 7:23401860-23401882 GGAATTTGGTTGGCTGAGACAGG + Intronic
1029036926 7:97532279-97532301 GGATTTTGCTTGGCAAACACAGG + Intergenic
1031382327 7:121102456-121102478 GGAAGTTACCTGGCTACAAAGGG - Intronic
1037134191 8:15442858-15442880 GGAAGATTCTTGTCTACAACTGG - Intronic
1037499287 8:19469946-19469968 GGAAGGTGCTTGGCTAAAAAGGG + Intronic
1044844869 8:96370953-96370975 GGAAGTGATTTGGTTAAAACAGG - Intergenic
1048165254 8:132056562-132056584 GGAATTTGTGTGGCTAAAAAAGG - Intronic
1050988271 9:12110956-12110978 GAAAGTTGTTTTGCTGAAACTGG - Intergenic
1051190551 9:14506773-14506795 GGGAGGTGCTTGGCTGAAAGGGG + Intergenic
1055694028 9:78863670-78863692 GCAAGTTCCTTGGCTGAAATGGG - Intergenic
1058113981 9:101064294-101064316 AGAAAGTGCTTGGCTAAACCTGG + Intronic
1059091299 9:111361478-111361500 GGAAGTTTCTTGGGTAAGCCGGG + Exonic
1061603791 9:131692906-131692928 ACAGGCTGCTTGGCTAAAACAGG + Intronic
1185940126 X:4308589-4308611 GGCAGGTTCTTTGCTAAAACTGG + Intergenic
1196924040 X:120614283-120614305 GGAAGTTACTTGGTAAACACAGG + Intronic
1197384610 X:125787701-125787723 GGAAGTTGCTTTTCTAATTCTGG + Intergenic