ID: 1179422155

View in Genome Browser
Species Human (GRCh38)
Location 21:41245292-41245314
Sequence CCCAGGGATGGAATGAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179422155_1179422164 15 Left 1179422155 21:41245292-41245314 CCAGGACTCATTCCATCCCTGGG No data
Right 1179422164 21:41245330-41245352 AGCTGTGCCCGTAGTGGTTGGGG No data
1179422155_1179422163 14 Left 1179422155 21:41245292-41245314 CCAGGACTCATTCCATCCCTGGG No data
Right 1179422163 21:41245329-41245351 CAGCTGTGCCCGTAGTGGTTGGG No data
1179422155_1179422168 27 Left 1179422155 21:41245292-41245314 CCAGGACTCATTCCATCCCTGGG No data
Right 1179422168 21:41245342-41245364 AGTGGTTGGGGTGGCTCATCTGG No data
1179422155_1179422161 9 Left 1179422155 21:41245292-41245314 CCAGGACTCATTCCATCCCTGGG No data
Right 1179422161 21:41245324-41245346 CTATGCAGCTGTGCCCGTAGTGG No data
1179422155_1179422165 18 Left 1179422155 21:41245292-41245314 CCAGGACTCATTCCATCCCTGGG No data
Right 1179422165 21:41245333-41245355 TGTGCCCGTAGTGGTTGGGGTGG No data
1179422155_1179422162 13 Left 1179422155 21:41245292-41245314 CCAGGACTCATTCCATCCCTGGG No data
Right 1179422162 21:41245328-41245350 GCAGCTGTGCCCGTAGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179422155 Original CRISPR CCCAGGGATGGAATGAGTCC TGG (reversed) Intronic