ID: 1179422159

View in Genome Browser
Species Human (GRCh38)
Location 21:41245309-41245331
Sequence CTGCATAGGCAAGTCTACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179422159_1179422170 23 Left 1179422159 21:41245309-41245331 CCTGGGTAGACTTGCCTATGCAG No data
Right 1179422170 21:41245355-41245377 GCTCATCTGGTGTTGGCCACTGG No data
1179422159_1179422169 16 Left 1179422159 21:41245309-41245331 CCTGGGTAGACTTGCCTATGCAG No data
Right 1179422169 21:41245348-41245370 TGGGGTGGCTCATCTGGTGTTGG No data
1179422159_1179422168 10 Left 1179422159 21:41245309-41245331 CCTGGGTAGACTTGCCTATGCAG No data
Right 1179422168 21:41245342-41245364 AGTGGTTGGGGTGGCTCATCTGG No data
1179422159_1179422164 -2 Left 1179422159 21:41245309-41245331 CCTGGGTAGACTTGCCTATGCAG No data
Right 1179422164 21:41245330-41245352 AGCTGTGCCCGTAGTGGTTGGGG No data
1179422159_1179422163 -3 Left 1179422159 21:41245309-41245331 CCTGGGTAGACTTGCCTATGCAG No data
Right 1179422163 21:41245329-41245351 CAGCTGTGCCCGTAGTGGTTGGG No data
1179422159_1179422161 -8 Left 1179422159 21:41245309-41245331 CCTGGGTAGACTTGCCTATGCAG No data
Right 1179422161 21:41245324-41245346 CTATGCAGCTGTGCCCGTAGTGG No data
1179422159_1179422165 1 Left 1179422159 21:41245309-41245331 CCTGGGTAGACTTGCCTATGCAG No data
Right 1179422165 21:41245333-41245355 TGTGCCCGTAGTGGTTGGGGTGG No data
1179422159_1179422162 -4 Left 1179422159 21:41245309-41245331 CCTGGGTAGACTTGCCTATGCAG No data
Right 1179422162 21:41245328-41245350 GCAGCTGTGCCCGTAGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179422159 Original CRISPR CTGCATAGGCAAGTCTACCC AGG (reversed) Intronic