ID: 1179422160

View in Genome Browser
Species Human (GRCh38)
Location 21:41245323-41245345
Sequence CACTACGGGCACAGCTGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179422160_1179422170 9 Left 1179422160 21:41245323-41245345 CCTATGCAGCTGTGCCCGTAGTG No data
Right 1179422170 21:41245355-41245377 GCTCATCTGGTGTTGGCCACTGG No data
1179422160_1179422168 -4 Left 1179422160 21:41245323-41245345 CCTATGCAGCTGTGCCCGTAGTG No data
Right 1179422168 21:41245342-41245364 AGTGGTTGGGGTGGCTCATCTGG No data
1179422160_1179422169 2 Left 1179422160 21:41245323-41245345 CCTATGCAGCTGTGCCCGTAGTG No data
Right 1179422169 21:41245348-41245370 TGGGGTGGCTCATCTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179422160 Original CRISPR CACTACGGGCACAGCTGCAT AGG (reversed) Intronic