ID: 1179422163

View in Genome Browser
Species Human (GRCh38)
Location 21:41245329-41245351
Sequence CAGCTGTGCCCGTAGTGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179422158_1179422163 -2 Left 1179422158 21:41245308-41245330 CCCTGGGTAGACTTGCCTATGCA No data
Right 1179422163 21:41245329-41245351 CAGCTGTGCCCGTAGTGGTTGGG No data
1179422153_1179422163 15 Left 1179422153 21:41245291-41245313 CCCAGGACTCATTCCATCCCTGG No data
Right 1179422163 21:41245329-41245351 CAGCTGTGCCCGTAGTGGTTGGG No data
1179422155_1179422163 14 Left 1179422155 21:41245292-41245314 CCAGGACTCATTCCATCCCTGGG No data
Right 1179422163 21:41245329-41245351 CAGCTGTGCCCGTAGTGGTTGGG No data
1179422157_1179422163 2 Left 1179422157 21:41245304-41245326 CCATCCCTGGGTAGACTTGCCTA No data
Right 1179422163 21:41245329-41245351 CAGCTGTGCCCGTAGTGGTTGGG No data
1179422159_1179422163 -3 Left 1179422159 21:41245309-41245331 CCTGGGTAGACTTGCCTATGCAG No data
Right 1179422163 21:41245329-41245351 CAGCTGTGCCCGTAGTGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179422163 Original CRISPR CAGCTGTGCCCGTAGTGGTT GGG Intronic