ID: 1179422169

View in Genome Browser
Species Human (GRCh38)
Location 21:41245348-41245370
Sequence TGGGGTGGCTCATCTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179422158_1179422169 17 Left 1179422158 21:41245308-41245330 CCCTGGGTAGACTTGCCTATGCA No data
Right 1179422169 21:41245348-41245370 TGGGGTGGCTCATCTGGTGTTGG No data
1179422160_1179422169 2 Left 1179422160 21:41245323-41245345 CCTATGCAGCTGTGCCCGTAGTG No data
Right 1179422169 21:41245348-41245370 TGGGGTGGCTCATCTGGTGTTGG No data
1179422159_1179422169 16 Left 1179422159 21:41245309-41245331 CCTGGGTAGACTTGCCTATGCAG No data
Right 1179422169 21:41245348-41245370 TGGGGTGGCTCATCTGGTGTTGG No data
1179422157_1179422169 21 Left 1179422157 21:41245304-41245326 CCATCCCTGGGTAGACTTGCCTA No data
Right 1179422169 21:41245348-41245370 TGGGGTGGCTCATCTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179422169 Original CRISPR TGGGGTGGCTCATCTGGTGT TGG Intronic