ID: 1179424729

View in Genome Browser
Species Human (GRCh38)
Location 21:41266747-41266769
Sequence TGGGGTTCCCACGACCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179424729_1179424739 3 Left 1179424729 21:41266747-41266769 CCCTCCTGGTCGTGGGAACCCCA 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1179424739 21:41266773-41266795 TTAGGGCCCATTTCTGGTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 105
1179424729_1179424737 -3 Left 1179424729 21:41266747-41266769 CCCTCCTGGTCGTGGGAACCCCA 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1179424737 21:41266767-41266789 CCAGCCTTAGGGCCCATTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1179424729_1179424742 21 Left 1179424729 21:41266747-41266769 CCCTCCTGGTCGTGGGAACCCCA 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1179424742 21:41266791-41266813 TGAGGAATGTCTCTTACTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179424729 Original CRISPR TGGGGTTCCCACGACCAGGA GGG (reversed) Intronic
900134599 1:1110283-1110305 TGGGGTCCCCTTGACCAAGAGGG + Intronic
900142309 1:1143780-1143802 TGGGGTCCCCTCGGCCAGGCGGG + Intergenic
900369012 1:2323258-2323280 TGCCGTCCCCACGACCAGGGTGG + Intronic
900911151 1:5597815-5597837 TGGGCTTCCCAAGGCAAGGAGGG + Intergenic
901753006 1:11423255-11423277 TGGGGTTCCCTTGGCCAAGAGGG - Intergenic
904001214 1:27339850-27339872 TGGGGGCGCCAGGACCAGGATGG + Intergenic
907387142 1:54133361-54133383 TGGGGTTCTCAGTACCAGGGGGG + Intronic
912329430 1:108804684-108804706 TGGGGTTCCTCAGACCATGAAGG + Intronic
915310298 1:155003014-155003036 TGGGGGTCCCACTTACAGGACGG - Intronic
916181114 1:162084563-162084585 TGGTGTTGCCACTATCAGGAGGG + Intronic
917630297 1:176884970-176884992 TGGGGTTTCCCCCACCAGCACGG - Intronic
920566641 1:206979445-206979467 TGGGTTTCTCACCACCAGAATGG - Intergenic
920813811 1:209312024-209312046 TGGAGTTCCCTCGACATGGAAGG - Intergenic
1068213865 10:53957343-53957365 TGGAGTTCTCAAGAACAGGACGG - Intronic
1069775051 10:70921948-70921970 TAGGGTTCCCTCTGCCAGGAGGG + Intergenic
1070930772 10:80259095-80259117 TGTTGTTCCTAGGACCAGGATGG - Intergenic
1072618241 10:97063664-97063686 TGGGGTTCCCACAATCAGGCTGG - Intronic
1075384060 10:122041800-122041822 TGGGGTTCCCCCAGCCCGGAGGG + Intronic
1076459782 10:130633968-130633990 TGGGGTTCCCTTGGCCAAGAGGG + Intergenic
1077424890 11:2470665-2470687 TGGGGTTCCCTCGGCCAAGTGGG + Intronic
1080467467 11:32511167-32511189 TGGGGTTGCCACGTACAGGATGG + Intergenic
1080518587 11:33046156-33046178 TGGTGTTCCCAAGGCCATGAGGG + Intronic
1084506149 11:69569751-69569773 TGGGGCTCCCAGGAAAAGGAAGG + Intergenic
1091225050 11:133951982-133952004 GGGGGCACACACGACCAGGAGGG + Intronic
1092144015 12:6202279-6202301 AGGGGTGCCCACGGCCAGCAGGG - Intronic
1092538924 12:9407586-9407608 TGGGGATCCCAACAACAGGAAGG + Intergenic
1092565669 12:9662686-9662708 TGTGGTTTCAACTACCAGGAAGG - Intergenic
1094515150 12:31121417-31121439 TGGGGATCCCAACAACAGGAAGG + Intergenic
1094515407 12:31122661-31122683 TGGGGTTCCCAAGAGCCGGGGGG - Intergenic
1095482440 12:42650202-42650224 TGGGGTTCCCTCAGCCAAGAGGG - Intergenic
1101347674 12:103901487-103901509 TGAGGTTCCAGCTACCAGGAGGG + Intergenic
1101724250 12:107376053-107376075 TGCGGTTCCTTCTACCAGGATGG + Intronic
1103202282 12:119097561-119097583 TGGGATACCCAACACCAGGAAGG + Intronic
1104441128 12:128794201-128794223 TGGCGTGCCCACCAGCAGGAGGG - Exonic
1104947543 12:132423354-132423376 CGGGGTTCGCAGGAGCAGGAGGG - Intergenic
1105404069 13:20119056-20119078 TGGGGCTCCCGGGACCAGCAGGG + Intergenic
1112537328 13:100272493-100272515 TGGGGTTCCCATGTGCAAGAAGG - Intronic
1112587860 13:100735768-100735790 AGGGGTGCCCCCGACCAAGAAGG - Intergenic
1113158464 13:107352318-107352340 TGGGGTCCCCTTGGCCAGGAGGG + Intronic
1113742900 13:112723711-112723733 TGGGGTTCCCTTGACCAAGAAGG + Intronic
1114961477 14:27896122-27896144 TGGCGTTCACACGACCTGGATGG - Intergenic
1118325509 14:64777851-64777873 TGGGGTTCCCCTAACCAAGAAGG - Intronic
1119193800 14:72702367-72702389 TGGGGTTCCCAGAGCCAGGCAGG - Intronic
1121563460 14:94891830-94891852 TGGGGTTCCCAAGACCATCGGGG - Intergenic
1121697074 14:95922417-95922439 TGAAATTCCCACCACCAGGATGG + Intergenic
1122647302 14:103203674-103203696 TGGGGTCCCCTTGACCAGGATGG - Intergenic
1122923947 14:104891336-104891358 GGGGGGTCCCAGGACCAGGGTGG + Intronic
1124286050 15:28401116-28401138 TGGGGTGCCCATCAGCAGGAAGG + Intergenic
1124296651 15:28510544-28510566 TGGGGTGCCCATCAGCAGGAAGG - Intergenic
1125577136 15:40763845-40763867 GGGCGGTCCCACGACCTGGAAGG - Intergenic
1128520042 15:68369266-68369288 TGGGGCGCCCACGACCAGCCTGG + Exonic
1128586226 15:68852802-68852824 TGGGATCCCCACGCCCCGGATGG - Intronic
1129780612 15:78268025-78268047 GGGGGTTCCAACTACCAGTAGGG - Intronic
1130986294 15:88847038-88847060 TGGGGTTCCCACGCAGGGGAGGG + Intronic
1133042226 16:3066806-3066828 TGGGTTTCCCACAACCACTATGG - Intronic
1133215297 16:4288561-4288583 TGGGGCTCCCCCGACCAGTAGGG + Intergenic
1135702320 16:24643145-24643167 TGGGGTTCCCATGAATGGGATGG - Intergenic
1137783286 16:51115603-51115625 TTGGGTTGCCACTACCTGGAAGG + Intergenic
1140097157 16:71884442-71884464 TGGCGTTTACACGTCCAGGAAGG - Intronic
1140393436 16:74607388-74607410 TGGGGTTGCCACAACCAAAATGG + Intergenic
1142412305 16:89923031-89923053 CGGGGTTCCCAGGGCCAAGAGGG + Intronic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1143351540 17:6291627-6291649 TGGGGTCCCCACTATCAGAAGGG + Intergenic
1144874630 17:18390979-18391001 TGGGCTTCCCTGGACCAGGGTGG - Intergenic
1145242675 17:21248914-21248936 TGGGGTTCTCAGGCCCAGGAGGG - Intronic
1148244544 17:46021846-46021868 GGGGATCCCCAGGACCAGGATGG - Intronic
1149475686 17:56959312-56959334 TGGGTTTCCCATGCCCAGGCTGG - Intronic
1150360847 17:64532604-64532626 TGGACTTCCCAGGACCAGCATGG + Intronic
1151943081 17:77304978-77305000 TGGGCTGCCCAGGACCAGGAGGG - Intronic
1152303333 17:79507867-79507889 TGGGCTGCCCAGGCCCAGGAAGG - Intronic
1152545809 17:80999625-80999647 TGGGGATCCCCCCACCAGCAGGG - Exonic
1156457672 18:37303874-37303896 TGGGATGCCTACGGCCAGGAGGG - Intronic
1157614746 18:48979705-48979727 TGGGGTACCCAGGGCCAGGGAGG - Intergenic
1159601605 18:70433382-70433404 TGGGGTCCCCTGGACCAAGAGGG + Intergenic
1162440646 19:10690097-10690119 TGGGTTCCCCAAGACCAGAATGG - Exonic
1162699335 19:12501964-12501986 TGGGGTTCCCTTGGCCAAGAAGG + Intronic
1162811677 19:13167834-13167856 TTGGTTTCTCACGACCCGGAAGG + Intergenic
1163705077 19:18807796-18807818 TGGGGTTCCCAGGTCTGGGAGGG - Intergenic
1163834100 19:19562894-19562916 TGTGCTTCCCAGGACCAGGTGGG + Intronic
1165500781 19:36187551-36187573 TGGGGTTTCACTGACCAGGATGG + Intronic
1165691709 19:37868716-37868738 TGGGGTTCCCTTGGCCAAGATGG + Intergenic
1165830876 19:38729612-38729634 GGAGGTTCCCCCGACCAGGTTGG + Exonic
1166054588 19:40280722-40280744 TGTGGTTCCCTCCACCTGGAGGG + Intronic
1166709409 19:44927137-44927159 TGGGGCAACCACGACCAAGAAGG - Intergenic
1166840405 19:45693504-45693526 CGGGGTTCGCACAACCAGCAGGG - Exonic
1167863074 19:52300628-52300650 TAGGGTCCCCACGACCAAGCTGG - Intronic
925484817 2:4316389-4316411 TCAGATTCCCACTACCAGGATGG + Intergenic
925808483 2:7675349-7675371 TGTGGTTCCCAGGACCATGCTGG - Intergenic
937207720 2:120247113-120247135 TGGGCTTCCCACAACCTGCACGG - Intronic
938353008 2:130612052-130612074 TGAGGTTTCCACAACCAGGGTGG - Intronic
942294786 2:174507091-174507113 TCAGGTTCCCACCACTAGGATGG - Intergenic
948317266 2:237037837-237037859 TGGGGCTCCCACCAGGAGGAGGG - Intergenic
1170445093 20:16418340-16418362 TGGGGTCCCCATGGCCAAGAGGG - Intronic
1171223276 20:23420723-23420745 CGGGGGTCCCACGACCTAGAAGG - Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1176251673 20:64124820-64124842 TGGGGTTCCCTTGGCCAAGAGGG + Intergenic
1179424729 21:41266747-41266769 TGGGGTTCCCACGACCAGGAGGG - Intronic
1180391192 22:12283837-12283859 TGGGGTTCAAACAACTAGGAAGG - Intergenic
1180408548 22:12580916-12580938 TGGGGTTCAAACAACTAGGAAGG + Intergenic
1181510961 22:23388550-23388572 TGGGGTTTCCAGGCCAAGGAGGG + Intergenic
1183107784 22:35627368-35627390 TGGGGTACCCAGGACGAGGACGG + Intronic
1183281729 22:36935962-36935984 GGGGGTTCCTGCTACCAGGATGG + Intronic
1183701363 22:39453108-39453130 TGGGGTTCCCTTGGCCAAGACGG + Intergenic
1184288670 22:43486655-43486677 TGGGGTGGCCACCACCATGAAGG - Intronic
953018487 3:39099443-39099465 TGGGACTCCCAGGCCCAGGAAGG + Exonic
954695353 3:52421747-52421769 TGGGGTTCCCACTACCTGTCTGG - Exonic
954913331 3:54127516-54127538 TGGGCTTCCCACGAGCAGCAAGG - Intronic
962274665 3:134002967-134002989 TGGAGTTCCCATGCCCAGGTGGG - Intronic
967180812 3:186902340-186902362 TGTGGTCCCAACTACCAGGAAGG + Intergenic
967316015 3:188153200-188153222 TTGGGTTCCCGCCTCCAGGAAGG - Intergenic
967925055 3:194639430-194639452 TTGGGCCCCCAGGACCAGGACGG - Intergenic
968758103 4:2427211-2427233 AGGGGGTGCCAGGACCAGGATGG - Intronic
969701515 4:8770313-8770335 TGGCCTTCCCACCACCAGGATGG + Intergenic
972673301 4:41234841-41234863 TAGGGTTCCCATGGCCAAGAGGG + Intergenic
978597475 4:110393762-110393784 TGGGGTCCCCTTGACCAAGAGGG - Intronic
979099815 4:116599794-116599816 GGAGGTTCCCCCGACCAGGTTGG + Intergenic
979914699 4:126416153-126416175 TGTGGTTTCCACGAGCTGGAGGG - Intergenic
981528017 4:145726521-145726543 TGGGGTTCCAGCTACCAGGGAGG - Intronic
983794979 4:171850795-171850817 TGGGGTTCCCTTGGCCAAGAGGG + Intronic
986691851 5:10319773-10319795 TGGGGTCCCCTTGGCCAGGAGGG + Intergenic
999450772 5:151676182-151676204 TAGGGTTCCCAGCACCATGAGGG - Exonic
999516780 5:152309896-152309918 TGGGGTCCCCTCGGCCAAGAGGG + Intergenic
1001528233 5:172444276-172444298 TGGAGTTCCCACTCCCTGGATGG + Intronic
1003079590 6:3010554-3010576 TGGGGTTCCCAGAAACAGGCAGG + Intronic
1003638939 6:7860384-7860406 TGGGATTCCCATGACAGGGAGGG - Intronic
1005861961 6:29908572-29908594 TGGGGTGCCAGGGACCAGGAGGG + Intergenic
1006075348 6:31529069-31529091 TGGGGTGCCAAGGACCAGGAGGG - Exonic
1006691526 6:35891577-35891599 TGGGGTGCCCACCACCACGCTGG - Intronic
1008034106 6:46728292-46728314 TTTGGTTGCCACAACCAGGAGGG + Intronic
1008394446 6:50990650-50990672 TGGGTTACCCAAGACCATGAAGG + Intergenic
1011623137 6:89261415-89261437 TGGGGTCCCCTTGACCAAGAGGG - Intronic
1012710923 6:102603611-102603633 TGGGGTTTCCATGACCAAGAGGG - Intergenic
1012853796 6:104477114-104477136 TGAAGTTCCCAAGACTAGGAGGG - Intergenic
1013321906 6:109000598-109000620 TGGGGTCCCCACCAACATGAAGG + Exonic
1017837665 6:158193795-158193817 TGGGGTTTCACCGAGCAGGATGG - Exonic
1019326600 7:441481-441503 GTGGGTGCCCACCACCAGGATGG + Intergenic
1020446090 7:8269393-8269415 TGTGGGTCCCAGGACCATGAGGG + Intergenic
1020853614 7:13389457-13389479 TGGTATTCCCACAACCAAGAAGG + Intergenic
1023921293 7:44632190-44632212 TGGGATCCCCAAGAGCAGGAGGG + Intronic
1031278044 7:119756883-119756905 TGGGGTTCTCATCAGCAGGAAGG - Intergenic
1032279123 7:130486758-130486780 TCGAGTCCCCACGCCCAGGAGGG - Intronic
1033603740 7:142909582-142909604 TGTGGTGGCCACGACCTGGAAGG + Exonic
1033801994 7:144912567-144912589 TGGGGTTCCCTTGGCCAAGAGGG + Intergenic
1034581898 7:152050790-152050812 TTGAGTTTCCACCACCAGGATGG + Intronic
1035563722 8:627838-627860 TGGGGAGCCCAGGAACAGGAGGG + Intronic
1035767002 8:2114124-2114146 TGAGGTGGCCACGACAAGGATGG + Intronic
1037367561 8:18139382-18139404 TGGTGTTCCCTTGGCCAGGAAGG - Intergenic
1037720521 8:21439706-21439728 TGAGGTGGCCACCACCAGGAAGG + Intergenic
1038208299 8:25490537-25490559 TGGGATTCCCATGAACAGGCCGG - Intronic
1040618383 8:49062746-49062768 TGGTGTTCCCAGGGCCAAGACGG + Intronic
1041917893 8:63154197-63154219 TGGGGTTCCCTTGGCCAAGAGGG + Intergenic
1044607416 8:94059268-94059290 TGGGGTTCCCTTGGCCAAGAGGG - Intergenic
1047958673 8:129995074-129995096 GAGGGTTCCCCCAACCAGGAAGG + Intronic
1048965583 8:139612154-139612176 TGCCGTTCCCACTACCTGGAAGG - Intronic
1051174742 9:14350091-14350113 CGGGTTTCCCAGGCCCAGGAGGG - Intronic
1052247085 9:26348882-26348904 TGGGCTTCCCAGGTCGAGGAGGG + Intergenic
1056546020 9:87614735-87614757 CGGGGAGCCCACGACAAGGATGG - Intronic
1057097835 9:92328070-92328092 TGGGGTCCCCTTGACCAAGAGGG + Intronic
1061151967 9:128833897-128833919 AGAGGTTCCCACGACCAGGCGGG + Intronic
1061608182 9:131727455-131727477 TGGGGTTCAGAGGCCCAGGAAGG + Intronic
1062395492 9:136351032-136351054 TGGAGCTCCCCCGAGCAGGACGG + Intronic
1062462869 9:136669164-136669186 TGGAGCTCCCACACCCAGGAAGG - Intronic
1191090542 X:56616214-56616236 TGGTGTTCCAAAGGCCAGGAGGG + Intergenic
1192864365 X:75115714-75115736 TGGGGTCCCCTTGGCCAGGAGGG - Intronic
1195981660 X:110584987-110585009 TGGGGTCCCCTTGACCAAGAAGG - Intergenic