ID: 1179424889

View in Genome Browser
Species Human (GRCh38)
Location 21:41268113-41268135
Sequence GTACAGTCCTGGGCTAAGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179424889_1179424894 30 Left 1179424889 21:41268113-41268135 CCGATCTTAGCCCAGGACTGTAC 0: 1
1: 0
2: 2
3: 6
4: 95
Right 1179424894 21:41268166-41268188 TCTTACAAGACTGACTGGTAGGG 0: 1
1: 0
2: 0
3: 3
4: 88
1179424889_1179424892 25 Left 1179424889 21:41268113-41268135 CCGATCTTAGCCCAGGACTGTAC 0: 1
1: 0
2: 2
3: 6
4: 95
Right 1179424892 21:41268161-41268183 ATTGTTCTTACAAGACTGACTGG 0: 1
1: 0
2: 3
3: 11
4: 114
1179424889_1179424893 29 Left 1179424889 21:41268113-41268135 CCGATCTTAGCCCAGGACTGTAC 0: 1
1: 0
2: 2
3: 6
4: 95
Right 1179424893 21:41268165-41268187 TTCTTACAAGACTGACTGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179424889 Original CRISPR GTACAGTCCTGGGCTAAGAT CGG (reversed) Intronic
900935891 1:5766244-5766266 GCCCAGTCCTAGGCAAAGATGGG + Intergenic
901704812 1:11065385-11065407 GAACAGCCCTGTCCTAAGATAGG - Intergenic
901798229 1:11692443-11692465 GTACCTTCCTGGGCACAGATGGG - Intronic
902872758 1:19324413-19324435 GTAGAGTCCTCGGCTTAGAAGGG + Intronic
904973266 1:34435490-34435512 GCACAGTCCAGGGCTATGAAAGG - Intergenic
905523895 1:38622204-38622226 GCACAGTCGTCTGCTAAGATAGG - Intergenic
908306073 1:62818013-62818035 GTGCAGTCATGGGCAAGGATTGG + Intronic
914858070 1:151366446-151366468 GTACAGTCCTGGGGTGGGAGTGG + Exonic
1070306676 10:75243750-75243772 GGACAGTCCTGTGGTGAGATTGG + Intergenic
1071967580 10:90867979-90868001 GAGAAGTCCTGGGCTCAGATAGG - Intergenic
1081261470 11:40966577-40966599 GTACATACCTATGCTAAGATAGG - Intronic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1088043013 11:105411572-105411594 GTACAGTCCTGGGCTCAGAATGG - Intergenic
1088514064 11:110609538-110609560 GTTCAGTCCTGGGGAAAGAAAGG + Intronic
1089005927 11:115090766-115090788 GAACAGGCCAGAGCTAAGATGGG + Intergenic
1090703392 11:129315775-129315797 GGCCAGTCGTGGGCTAAGCTAGG - Intergenic
1121089019 14:91168477-91168499 GTACAATCATGGGCCCAGATGGG - Intronic
1124079335 15:26476763-26476785 TTAGACTCCTGGGCTAAGACAGG - Intergenic
1125852992 15:42921750-42921772 GTACACTGGTGGGCAAAGATGGG - Intergenic
1127861298 15:62996590-62996612 GGAGAGTCCTGGGCTGAGACAGG + Intergenic
1132827695 16:1913373-1913395 GGACAGTCCTGGGCTGTGGTCGG - Intronic
1133972322 16:10577221-10577243 GGACAGCCCTGGGCTAAGATTGG - Intronic
1137033035 16:35543264-35543286 GTTCAGTGCTGGGCTTAGCTGGG + Intergenic
1137273936 16:46921093-46921115 GTCCAGTCCAGGGATCAGATGGG + Intronic
1141957667 16:87383461-87383483 GTGCAGACCTGGGCCAAGCTGGG + Exonic
1145797828 17:27666220-27666242 GTAGAGGCCTAGGCTAAGGTGGG - Intergenic
1146275569 17:31513602-31513624 GTACTGTCCTGGGCTAACCAAGG + Intronic
1153861062 18:9207235-9207257 GAAAAGTACTGTGCTAAGATTGG + Intronic
1155652942 18:28162381-28162403 GTACAGAACTGGGCCAAGGTGGG + Intronic
1161361352 19:3851701-3851723 GTACAGTCCCAAGCTAAGAATGG + Intronic
1162799356 19:13102521-13102543 GAACAGTGCTGGGGTAAGAGGGG - Exonic
1165760955 19:38320905-38320927 GGACAGTCCTAGGCTTAGAGGGG - Intronic
1166023084 19:40050689-40050711 GCCCAGTCCTAGGCCAAGATTGG - Intronic
1166025993 19:40085104-40085126 GTCCAGACCTAGGCCAAGATAGG - Intronic
1167934916 19:52897843-52897865 GAAGAGTCCTGGGCTATGAGGGG + Intergenic
925125653 2:1453840-1453862 CTACTATCCTGGACTAAGATTGG + Intronic
926641898 2:15245906-15245928 GTACAACCCTTAGCTAAGATTGG - Intronic
928362249 2:30674647-30674669 TTACAATCCTGGGCTAACCTTGG - Intergenic
930701938 2:54467207-54467229 GTAAAGTCTTGGGCTGGGATAGG + Intronic
930805175 2:55483278-55483300 GTGCAGTTCTGGAATAAGATAGG - Intergenic
931652979 2:64485208-64485230 TTACAGTCCTGAGTTAAAATCGG - Intergenic
931694376 2:64860500-64860522 GTAGAGGCCTGGGGTAAGACTGG - Intergenic
932441841 2:71742547-71742569 GGACAGTCCTGGGCTAGGTGAGG + Intergenic
935883207 2:107587597-107587619 GTAAAGTCCTGGGAAAATATGGG - Intergenic
942858732 2:180584395-180584417 ACACAGTCCTGGGCTTAGGTAGG + Intergenic
943579962 2:189673539-189673561 AAACAGTTCTGGGCTAAGAATGG - Intergenic
945821916 2:214674844-214674866 GAAAAGTCCAGGGATAAGATTGG - Intergenic
947899965 2:233713055-233713077 GTCCAGCCCTGGGCTGAGAGTGG + Exonic
947900666 2:233718884-233718906 GTCCAGCCCTGGGCTGAGAGTGG + Exonic
947902050 2:233729190-233729212 GTCCAGCCCTGGGCTGAGAGTGG + Exonic
948409033 2:237744865-237744887 TTCCCGTCCTGGGCTAAGGTGGG + Intronic
1169390188 20:5184350-5184372 ATACAGTCCTGGGGAAAGATAGG + Intronic
1169812604 20:9623614-9623636 GTACAGTATTAGACTAAGATAGG + Intronic
1170712287 20:18802238-18802260 ATACAGACCTGGGCTGAGACTGG - Intergenic
1176430633 21:6573512-6573534 GTCCAGACCTGGGCTAACACGGG - Intergenic
1178328161 21:31662018-31662040 GTACTGTCCTGGGCTAATGAAGG - Intronic
1179424889 21:41268113-41268135 GTACAGTCCTGGGCTAAGATCGG - Intronic
1179706027 21:43180974-43180996 GTCCAGACCTGGGCTAACACGGG - Intergenic
1181033953 22:20161069-20161091 CTAGAGTCCTGGGCTGAGCTGGG + Intergenic
1182129731 22:27842184-27842206 GGACAGTCCTGGGCAAAGTGTGG + Intergenic
953607592 3:44421649-44421671 GCACACTCCTGGGCTGAAATGGG + Intergenic
953746785 3:45580611-45580633 GTAAAGTCCTGAGCTCAGACTGG - Intronic
957539271 3:81547308-81547330 GTAAAGTCCTCGGATAAGAACGG + Intronic
958673843 3:97240042-97240064 GTTCCTTCCTGTGCTAAGATTGG + Intronic
961611530 3:128143600-128143622 ATGCAGGCCTGGGCTATGATGGG - Intronic
963294699 3:143533068-143533090 GTACAGGCCTGGGCCCACATGGG - Intronic
966244979 3:177797402-177797424 GTACTGTGTTGGGCAAAGATAGG + Intergenic
967108450 3:186272409-186272431 GTACAGACCTTGGCTAGGGTGGG - Intronic
967240594 3:187435758-187435780 GTAGAGCCATGGGCAAAGATAGG - Intergenic
968456649 4:703933-703955 GAACAGTCCTGGGCTGAGTGTGG - Intergenic
970302977 4:14701401-14701423 GCACAATACTGGGCAAAGATAGG + Intergenic
972627425 4:40814222-40814244 AAACAGTCCTGGACTTAGATAGG + Intronic
973305735 4:48647248-48647270 GTCCTATCCTGTGCTAAGATGGG - Intronic
975374970 4:73632569-73632591 GTACAGTGCTGGGCTCAGTGGGG + Intergenic
978321681 4:107503370-107503392 GCACAGACCTGGGTTAACATTGG - Intergenic
984020132 4:174475285-174475307 GTACAGTTCTGGGCTTAGTGAGG + Intergenic
985722708 5:1498338-1498360 GCACAGTCCTGGGCTTGGCTTGG - Intronic
994179024 5:96743609-96743631 GGACTGCCCTGGCCTAAGATGGG + Intronic
996250312 5:121320533-121320555 GCCCAGTCATGGGCAAAGATGGG - Intergenic
998281620 5:140814257-140814279 ATACAGTCCTAGGCTAGTATGGG - Intronic
999317025 5:150590905-150590927 GCCCAGTCCTGGTCTAAGAAGGG + Intergenic
1000816776 5:165932396-165932418 ATACATTCCTGTGCTCAGATTGG + Intergenic
1000957194 5:167557615-167557637 GTACAGTCTCAGGCTAGGATCGG - Intronic
1001932316 5:175681954-175681976 GTACAGCCCGTGGCTAAGAATGG + Intronic
1003629533 6:7774042-7774064 GTATAGTCCTGGGCCAAGGTGGG + Intronic
1009979529 6:70710908-70710930 GTGGAGTCCTAGGCTAATATGGG - Intronic
1014424224 6:121284528-121284550 GTACAGTTGTGAGCTAAGAATGG - Intronic
1014795217 6:125716935-125716957 GAACTGTCCTGGGCCAAGAATGG - Intergenic
1017756385 6:157532668-157532690 GTACAGACCAGAGCTGAGATAGG + Intronic
1018629382 6:165809232-165809254 CTGCAGTCCTGGACTAAGCTGGG + Intronic
1018718208 6:166551898-166551920 GAACAGTCTTGGGCACAGATAGG + Intronic
1020227935 7:6294883-6294905 ATTCAGTCCTTGGCTAAAATAGG - Intergenic
1033604423 7:142915426-142915448 GTACAGTCTGGGCCTTAGATGGG + Intronic
1035062862 7:156082137-156082159 GAACAGTCCTGGGATGAGATGGG - Intergenic
1042022179 8:64379584-64379606 CTGCAGTCCTGGGCCAAGCTGGG + Intergenic
1049224808 8:141445099-141445121 GCACAGTCCTGGGCTCTGATTGG - Intergenic
1187732004 X:22264760-22264782 TTACAGTCCTGGGCTGGGAAGGG + Intergenic
1192366419 X:70477502-70477524 GGACAGTCCAGGGCTTAGGTTGG + Intronic
1193265571 X:79464360-79464382 GTACAGTGCTGGGCTTAGCAGGG + Intergenic
1193308271 X:79975142-79975164 GTACAGTGCTGGGTTAAGTGGGG - Intergenic
1196960729 X:120997883-120997905 GTGCAGGCCTAGGCTAATATGGG - Intergenic
1197327231 X:125108921-125108943 GTACAGTCTTGGGATAAGAAGGG - Intergenic
1197394297 X:125907412-125907434 GTATAGTGCTGGGCTCAGTTTGG - Intergenic
1199859056 X:151783351-151783373 GTACAGACCTGGGCACAGAGTGG + Intergenic