ID: 1179427723

View in Genome Browser
Species Human (GRCh38)
Location 21:41295229-41295251
Sequence TACCTCAATTTTCCTACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179427723_1179427726 0 Left 1179427723 21:41295229-41295251 CCAGGTGTAGGAAAATTGAGGTA No data
Right 1179427726 21:41295252-41295274 TTCCTCTTGGTTCTTTACTAGGG No data
1179427723_1179427725 -1 Left 1179427723 21:41295229-41295251 CCAGGTGTAGGAAAATTGAGGTA No data
Right 1179427725 21:41295251-41295273 ATTCCTCTTGGTTCTTTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179427723 Original CRISPR TACCTCAATTTTCCTACACC TGG (reversed) Intergenic
No off target data available for this crispr