ID: 1179429828

View in Genome Browser
Species Human (GRCh38)
Location 21:41313349-41313371
Sequence GTGTTGAGTAAGATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179429828_1179429833 0 Left 1179429828 21:41313349-41313371 CCTTGCTCCATCTTACTCAACAC 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1179429833 21:41313372-41313394 CACCCTGCGTCTGCACTCAGGGG 0: 1
1: 0
2: 2
3: 8
4: 140
1179429828_1179429830 -2 Left 1179429828 21:41313349-41313371 CCTTGCTCCATCTTACTCAACAC 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1179429830 21:41313370-41313392 ACCACCCTGCGTCTGCACTCAGG 0: 1
1: 0
2: 2
3: 13
4: 95
1179429828_1179429832 -1 Left 1179429828 21:41313349-41313371 CCTTGCTCCATCTTACTCAACAC 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1179429832 21:41313371-41313393 CCACCCTGCGTCTGCACTCAGGG 0: 1
1: 0
2: 3
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179429828 Original CRISPR GTGTTGAGTAAGATGGAGCA AGG (reversed) Intronic
901723569 1:11220606-11220628 ATGTTTAATAAGATGGAGGAAGG + Intronic
907150239 1:52279037-52279059 GTGTTCAGTAAGATGTGGCTAGG - Intronic
908296311 1:62717064-62717086 GTGTTGAATAAGATAGATAAAGG - Intergenic
908415215 1:63906778-63906800 GTGGTGAGCAAAATGGAGAATGG - Intronic
911818138 1:102381050-102381072 GAGTTGAGTAAGATAAAGCAAGG - Intergenic
913325717 1:117626715-117626737 GTGTTGAGTAACATGAAACTTGG + Exonic
913474209 1:119221272-119221294 GTGTTGACTATAAGGGAGCATGG - Intergenic
915647198 1:157281389-157281411 GTGTTGAGGAAGGTAGAGCAGGG + Intergenic
916626651 1:166565335-166565357 CTATGGAGAAAGATGGAGCAGGG - Intergenic
917339623 1:173961877-173961899 CTCTTGTGTAAGACGGAGCAGGG + Exonic
919090606 1:192974659-192974681 GAGTTGAGAAAGATGGAAGAAGG + Intergenic
919253386 1:195089592-195089614 ATGTTGAGGAAGAGGGAGCCTGG - Intergenic
919749160 1:201025816-201025838 GTGTTGAGTCAGGGGAAGCAGGG + Intergenic
920584749 1:207146679-207146701 GTGGGCAGTAAGATGGAGAAGGG + Intergenic
920811902 1:209293763-209293785 GTGTTGAGAAAGACCAAGCACGG + Intergenic
922002753 1:221496517-221496539 GTGTTTAGTGAGAAGGAGCCTGG + Intergenic
924421719 1:243916363-243916385 GTGTTGAATATGTTGGAGCAGGG - Intergenic
1063785203 10:9375312-9375334 GTGTTCAGTAATATTGATCAAGG - Intergenic
1065283657 10:24165997-24166019 GTGGGGAGGAGGATGGAGCATGG - Intronic
1065870408 10:29951537-29951559 GTGATGAGTACGAAGGAGCTTGG + Intergenic
1068470797 10:57460393-57460415 GTGTTGAACAAGATGCATCAAGG - Intergenic
1070574682 10:77668825-77668847 GTGGTGAGTGAGATGGAGCGTGG - Intergenic
1070614493 10:77958932-77958954 TTTTAGAGTCAGATGGAGCAGGG + Intergenic
1075533302 10:123248736-123248758 GTATAGAGGAAGTTGGAGCAGGG + Intergenic
1077793140 11:5462628-5462650 GAGTTGAGTAATGTGCAGCAAGG + Intronic
1077849694 11:6063480-6063502 GTGTTGTTTAAGATGAAGAAAGG - Intergenic
1077916366 11:6614356-6614378 GACCTGAGTATGATGGAGCATGG + Exonic
1078673933 11:13391646-13391668 ATGTTGAGTAAGATGGATATTGG - Intronic
1078972613 11:16431212-16431234 GTGATGAGTGATATGAAGCATGG - Intronic
1079247549 11:18763921-18763943 GTGTGGAGGAAGAAAGAGCATGG - Intronic
1079405991 11:20146186-20146208 TTGTAGAGAAAGAAGGAGCAAGG + Intergenic
1080497456 11:32833847-32833869 GTGATGAGTACTATGGAGAAAGG + Intronic
1081582950 11:44365055-44365077 AAATTGAGTGAGATGGAGCAGGG - Intergenic
1083414046 11:62513814-62513836 GTGGTGGGTAGGATGGAGAAGGG - Intronic
1084073542 11:66754074-66754096 GTGTTCAGGAAGAAGGAGAATGG + Intronic
1090770952 11:129919517-129919539 TTGTTCACTATGATGGAGCATGG + Intronic
1092078341 12:5691931-5691953 GTGGTGAATAAGGTGAAGCATGG + Intronic
1093757986 12:22874195-22874217 GTGTAGAGAAAGAAGGAGGAGGG - Intergenic
1095184357 12:39184689-39184711 GTGTTGAGGGGGATGGAGGATGG - Intergenic
1095787126 12:46122114-46122136 TTGTTGTGTAAGATGGGGGAAGG + Intergenic
1097408082 12:59215825-59215847 ATGATGAGTAAGAGTGAGCAAGG + Intergenic
1099594454 12:84642117-84642139 GTGGGGAGTAAGAGAGAGCATGG - Intergenic
1099979667 12:89583840-89583862 GTGTTGAGGAAGGTGAGGCAAGG + Intergenic
1100414774 12:94360232-94360254 GTGTTGAATAAGATTGACAAGGG - Intronic
1101632304 12:106506892-106506914 GGGTTGAGTGGGAGGGAGCATGG + Intronic
1105633020 13:22190077-22190099 GTGTTGAGTACTGAGGAGCACGG - Intergenic
1106780302 13:33052329-33052351 GTGATGGGGAAGATGGAGAAGGG + Intronic
1107447876 13:40484447-40484469 GTGATGAGTAATGGGGAGCAGGG + Intergenic
1107526164 13:41233835-41233857 ATGCTGAGTAAGATGGAAAAAGG + Intronic
1109014453 13:56991786-56991808 GTGATGAGTAAGATCAAGCTTGG - Intergenic
1111367786 13:87272296-87272318 AAGATGAGGAAGATGGAGCATGG + Intergenic
1111624010 13:90760180-90760202 GTGTTGAGTAAAATGAAGTTTGG - Intergenic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1121167339 14:91817784-91817806 GAGTTGGGGAAGATGGAGGAAGG + Intronic
1122240324 14:100360749-100360771 GTGTTCATTAAGATTGTGCATGG - Intronic
1124097948 15:26666863-26666885 GCGTTGAGCAAGAAGGATCAGGG + Intronic
1124182553 15:27490466-27490488 GTGTTGACTAAGATGGAAAATGG - Intronic
1125082635 15:35693519-35693541 GTGTTGAGTAAGATGCTGGCAGG + Intergenic
1126198936 15:45963565-45963587 GAGTTGAGTAAAAAGGAGAAGGG + Intergenic
1126672151 15:51126251-51126273 GTGGGGAGTAAGAAGGAGCCTGG + Intergenic
1126884150 15:53131385-53131407 CTGCTGAGAAAGATGGACCAAGG - Intergenic
1127684879 15:61333655-61333677 ATGTTGAGAAAGATGGAGATAGG + Intergenic
1129436278 15:75543323-75543345 GTGTTGAGTATGATGTAGTATGG - Intronic
1129578346 15:76778042-76778064 CTGTTGGGTAAGATTCAGCATGG + Intronic
1131647984 15:94366734-94366756 GGGTTGAGTAAAGTGGGGCATGG - Intronic
1134168528 16:11949746-11949768 GTGTTAAAGAAGAGGGAGCAAGG - Intronic
1139319691 16:66104231-66104253 GTGTTGAGTAGGAAGTGGCATGG + Intergenic
1139525977 16:67516959-67516981 GTGTTAAGTGAGAAGGAGGAAGG + Intergenic
1140728593 16:77835990-77836012 GTGGTTAGGAAGATGGAGCTGGG - Intronic
1140866228 16:79064944-79064966 GTGTTTATAGAGATGGAGCATGG + Intronic
1141186767 16:81793176-81793198 GTGTTGGATAAGATGGTGCTGGG + Intronic
1141302278 16:82828177-82828199 GTGTTGAGGAAGAGAGGGCAAGG + Intronic
1143334629 17:6163074-6163096 GTGCTGAGAGAGTTGGAGCAGGG - Intergenic
1144823025 17:18088641-18088663 CTGTGTACTAAGATGGAGCAGGG - Intronic
1145105148 17:20109216-20109238 CAGTGGAGTAGGATGGAGCAGGG + Intronic
1147138736 17:38449830-38449852 GTGCTGAGCAAGCTGGAGGAAGG + Intronic
1148181975 17:45612725-45612747 GTGTTGGGGGAGATGGGGCATGG + Intergenic
1148266884 17:46232975-46232997 GTGTTGGGGGAGATGGGGCATGG - Intergenic
1149441034 17:56674005-56674027 ATGGTAAGAAAGATGGAGCACGG + Intergenic
1151059902 17:71080016-71080038 GGGGAGAGTAAGATGAAGCAAGG + Intergenic
1151245919 17:72794567-72794589 GTGTAGAGAAGGAGGGAGCAGGG - Intronic
1151382537 17:73735693-73735715 GTGGTGAGTAAGGGGGGGCAGGG - Intergenic
1151405926 17:73886153-73886175 GTGTGGCCTGAGATGGAGCATGG - Intergenic
1155861370 18:30904912-30904934 GTGTTGATGATGGTGGAGCAAGG + Intergenic
1156228831 18:35134570-35134592 GTGGTGGGTACCATGGAGCAGGG + Intronic
1157065524 18:44344972-44344994 GTGTTTGGTTAGATGGTGCATGG + Intergenic
1157543075 18:48525907-48525929 TTGGTGAGGAAGAAGGAGCATGG - Intergenic
1158410254 18:57199024-57199046 GGGCTGAATAAGATGGTGCATGG + Intergenic
1159972435 18:74670712-74670734 GTGTTGCTTAGGCTGGAGCACGG + Intronic
1161920277 19:7260721-7260743 GGGTTGAATGAGATGGTGCAGGG - Intronic
1166391033 19:42409027-42409049 GTGGGGAGTAGGATGGTGCAGGG + Intronic
926074041 2:9926105-9926127 GGGTAGAGTAAGCTGGAGCCTGG - Intronic
926622685 2:15061245-15061267 GTGTTGACTGAGATGCAGCCTGG + Intergenic
927114742 2:19888966-19888988 GTGTGGAGGCAGATGGAGCAAGG - Intergenic
927352226 2:22129577-22129599 GTTTTGAGCAAAAAGGAGCAAGG + Intergenic
936160044 2:110078014-110078036 CCTTTGAGTGAGATGGAGCAGGG - Intergenic
936184620 2:110293339-110293361 CCTTTGAGTGAGATGGAGCAGGG + Intergenic
936564743 2:113574209-113574231 CTGTTGAGAAAGAGGCAGCAGGG + Intergenic
937296818 2:120814499-120814521 GTGTTGGGTGGGGTGGAGCAGGG + Intronic
937937438 2:127257457-127257479 GTGCTGAGGAAGATGCATCAAGG - Exonic
938111201 2:128566522-128566544 GTGGTGAGTAAGGTGGAGGTGGG + Intergenic
940967055 2:159850361-159850383 GTGTTGAGCCAGATTGAACAAGG - Exonic
940992394 2:160110887-160110909 TTGTTGAGGAAGAGGGAGCCTGG + Intronic
941331505 2:164183067-164183089 ATCTTGAGTAATAAGGAGCAAGG + Intergenic
944840581 2:203620156-203620178 GTGTTGAGTAATATGCAACATGG - Intergenic
946213452 2:218165455-218165477 GTGTGGGGTAAGATGGAATATGG + Intronic
947150656 2:227111838-227111860 GTGTTGACTAAAATTGAGGAAGG + Intronic
947197294 2:227581551-227581573 GTGTTGGGGAAGAGGGACCATGG + Intergenic
948234299 2:236376254-236376276 GTGTTGTGAAAGATGGCGGAAGG + Intronic
1169510271 20:6256309-6256331 GTGTTTAGGAAAATGGAGGAAGG + Intergenic
1173663788 20:44751638-44751660 GAGATGCGTAAGAGGGAGCAGGG - Exonic
1175600294 20:60267342-60267364 GTGGAAAGTGAGATGGAGCAGGG + Intergenic
1175689574 20:61055895-61055917 GTGTGGAGTAACAGTGAGCATGG + Intergenic
1176669568 21:9720164-9720186 GTTTTGAGTACAATAGAGCAGGG + Intergenic
1179429828 21:41313349-41313371 GTGTTGAGTAAGATGGAGCAAGG - Intronic
1181968798 22:26674751-26674773 GCTTTGAGTGAAATGGAGCAAGG - Intergenic
1182826824 22:33272856-33272878 GTGTTGAGAAAGATGCGGAATGG + Exonic
1184062123 22:42089897-42089919 TTTTTGAGTGAGCTGGAGCACGG - Intronic
1185004791 22:48269548-48269570 GTTTTGTATAAGATGGAGTAGGG - Intergenic
951229502 3:20160555-20160577 GTGTAGTGTGAGATGGTGCAGGG + Intergenic
952433158 3:33245908-33245930 GAGTTGAATAAGATTGAACATGG + Intergenic
953007302 3:38990276-38990298 GAGGTGAGTGAGATGCAGCAGGG - Intergenic
953067371 3:39486125-39486147 TTGTTGTGTTAGAAGGAGCATGG + Intronic
955510922 3:59679521-59679543 GTCATGAGTAAGAAGGAGGAGGG + Intergenic
957413206 3:79866991-79867013 GAGCTGAGAAAGAAGGAGCAGGG - Intergenic
959301758 3:104611386-104611408 CTGTTGAGGAAGGTGGAGAAAGG - Intergenic
960554798 3:119016079-119016101 GGATTGAGTAAGAGGCAGCATGG + Intronic
961768691 3:129232140-129232162 GTTTGGACTAAGGTGGAGCAGGG - Intergenic
963683931 3:148414203-148414225 GTGTTTAGTAAGAAGAATCAAGG - Intergenic
964245338 3:154645600-154645622 GTGATCAGAAAAATGGAGCATGG + Intergenic
964551355 3:157888339-157888361 CTGTTGAGTAAGAGGGATAATGG - Intergenic
965102409 3:164316454-164316476 GTGTTGAGTAAGTTGTAGTGAGG + Intergenic
966906575 3:184530431-184530453 GGGAAGAGGAAGATGGAGCAGGG + Intronic
969173942 4:5385122-5385144 GGGTTGGGTAGGAAGGAGCAAGG + Intronic
969565755 4:7976644-7976666 GTGTTGTGTAAGATGAGGGATGG - Intronic
972205887 4:36772253-36772275 GTGTTTTGGAAGATGGAGAAAGG - Intergenic
977091097 4:92676568-92676590 CTGTTGATTCATATGGAGCATGG + Intronic
978475104 4:109118526-109118548 GTTTTGAGAAAGATGTACCACGG + Intronic
981791858 4:148546579-148546601 GCATTGAGTAAGATGCAGCCAGG - Intergenic
982650345 4:158080609-158080631 GTGGTTTGGAAGATGGAGCAAGG - Intergenic
982794702 4:159630611-159630633 GTGTTGAGTTGGAGGGAGGAAGG + Intergenic
983657683 4:170099552-170099574 GTGTTGAGTATGTTGGAGTTGGG + Intergenic
985402767 4:189608027-189608049 GTGTGGAGTCAGGTGCAGCAGGG - Intergenic
985405208 4:189631302-189631324 GTTTTGAGTACAATAGAGCAGGG - Intergenic
986289599 5:6389090-6389112 GTCTTCAGTGAGATGGAGCAGGG + Intergenic
986595133 5:9413436-9413458 GTATTGAGCAAGATGGAGCTAGG + Intronic
990562938 5:57001854-57001876 GTGTTGAGTATGTTGGAGTCAGG - Intergenic
990830574 5:59952371-59952393 GTGACGAGAAAGAGGGAGCAGGG - Intronic
995606595 5:113863156-113863178 GGCTTGAGTAAGATGGACCTGGG + Intergenic
996103764 5:119473758-119473780 GTGTTTAGTAAGATGGGATAGGG + Intronic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
996560741 5:124826276-124826298 GTGATGAGAGAGATGGAGTATGG + Intergenic
997696331 5:135863994-135864016 GTCTTCAGTATGATGGAGCCAGG - Intronic
998179494 5:139926563-139926585 CTGCTGAGTAAGAATGAGCAGGG + Intronic
1000026373 5:157362595-157362617 CTAATGAGTGAGATGGAGCAGGG - Intronic
1001420176 5:171580161-171580183 GTGGTGAGTGGGAGGGAGCAGGG - Intergenic
1002448866 5:179307831-179307853 GTGTGGAGTGTGATGGAGAAGGG - Intronic
1003314569 6:5000747-5000769 TTATTGAGTGAGCTGGAGCAGGG - Intronic
1004584331 6:16984961-16984983 GTATTGAATAAGAAGGACCATGG + Intergenic
1006125452 6:31834969-31834991 CTGTTGAGTGAGGGGGAGCAGGG + Exonic
1006175987 6:32121896-32121918 GCTTTGAGGAACATGGAGCAGGG - Intronic
1006779952 6:36625698-36625720 GAGTTATGTGAGATGGAGCAAGG + Intergenic
1006804556 6:36779695-36779717 GTGTTGGGTCAGCTGGGGCAGGG - Intronic
1007423028 6:41730894-41730916 TTGTTGAATAAGACGGTGCAGGG - Intronic
1007553341 6:42746540-42746562 GTGGTGAGAAAGATGGAGCGGGG + Intergenic
1012114020 6:95270822-95270844 GGGTAGGGTAAGATGGTGCAGGG - Intergenic
1015871323 6:137779277-137779299 GTGGTGAGAAGGATGGAGCGTGG + Intergenic
1019057444 6:169233486-169233508 GTGTTGTGGAAGGTGGTGCATGG - Intronic
1019151119 6:170006586-170006608 GTGCTGAGTAGGATGCAGCCAGG + Intergenic
1020042019 7:5011448-5011470 GTGTTGTATAAAGTGGAGCAAGG - Intronic
1020406614 7:7842574-7842596 GTATTGAGTAAAATGTGGCAAGG + Intronic
1022179009 7:27899911-27899933 GTGTTCAGGGAGCTGGAGCATGG + Intronic
1022244026 7:28540379-28540401 GTTTTGAGTTAGATTGAGGAGGG + Intronic
1026871585 7:73856005-73856027 GTGCTGAGTAAGAAAGAGAAGGG + Intergenic
1031446703 7:121864006-121864028 ATGTTGAGGAAGAAGGAGCTAGG + Intergenic
1031849754 7:126849808-126849830 GGGTTGGCTAAGTTGGAGCATGG - Intronic
1032703427 7:134402001-134402023 GGCTTGAGTAAGATGGAGGATGG + Intergenic
1032804476 7:135340880-135340902 CTGTTGTGTGGGATGGAGCAGGG - Intergenic
1032906845 7:136377957-136377979 GTGCTGAGGAAGATGGGGCCAGG - Intergenic
1037254929 8:16942439-16942461 GTGTTGAGTAACCTGGAACTGGG - Intergenic
1037994080 8:23340164-23340186 GAGTTGAGTAAACTGGAGAAAGG - Intronic
1039737542 8:40348642-40348664 GTGATGAGAAAGAGGGAGGAAGG - Intergenic
1040654528 8:49490712-49490734 GTGTTCACTAAAATGGGGCAGGG + Intergenic
1041077140 8:54178915-54178937 GTGCTAGGTAAGATGGGGCAGGG - Intergenic
1041146008 8:54876316-54876338 GTGTAGAGGAAGGTGGAGTAGGG + Intergenic
1041581662 8:59467046-59467068 TTGTTGATTAAGATGTATCATGG + Intergenic
1041976608 8:63805909-63805931 GTGTTTAGTAGGAAGGAGCCAGG + Intergenic
1042954883 8:74239018-74239040 GTGATGAGTAAAATGGGGGAGGG + Intronic
1043203424 8:77404246-77404268 ATATTGAGTGAGATGTAGCAGGG + Intergenic
1047706800 8:127507160-127507182 CTGTTGCCTAAGCTGGAGCATGG - Intergenic
1049557984 8:143292990-143293012 GTGTTCTGCAAGATGGAGCCAGG + Exonic
1051310905 9:15770725-15770747 GTAGTGAGTAAGATAGTGCATGG + Intronic
1057829475 9:98395778-98395800 GTGGTTAGAAGGATGGAGCAAGG + Intronic
1058843789 9:108935386-108935408 GTGTAAAGTAAGATGGAGCAAGG + Intronic
1060367843 9:123037112-123037134 GTGTTCAGTGAGATGGAAGATGG + Intronic
1203656296 Un_KI270753v1:703-725 GTTTTGAGTACAATAGAGCAGGG - Intergenic
1186622669 X:11257876-11257898 AAGTTGAGTAAGAGGGGGCAGGG + Intronic
1187117822 X:16371284-16371306 TTGTTGAATAATATGGAGCTGGG + Intergenic
1189064000 X:37786647-37786669 TTGTTGAGAAAAATGGAGAATGG + Intronic
1189707234 X:43770995-43771017 GTGTTGACTAAGATGGAACATGG - Intronic
1191026056 X:55914674-55914696 AAGTTGAGAAAGAAGGAGCATGG + Intergenic
1193695585 X:84703752-84703774 GAGTTGAGTAAGTTGGAGCATGG + Intergenic
1196054329 X:111338965-111338987 GGGTTGAGTAAGATGAGGCCAGG - Intronic
1196766790 X:119253288-119253310 GTGTTAAGTAATATGTACCAAGG - Intergenic
1197280597 X:124531072-124531094 GGGTTGAGGAAGGTTGAGCAAGG + Intronic
1197324825 X:125080058-125080080 ATCTTGAGTAACATGGAGCTAGG - Intergenic
1197634739 X:128902416-128902438 ATGTTGTGTAAAATGAAGCACGG - Intergenic