ID: 1179431991

View in Genome Browser
Species Human (GRCh38)
Location 21:41327915-41327937
Sequence GACCCACTGTGCATGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179431991_1179431995 18 Left 1179431991 21:41327915-41327937 CCTGTCAGCATGCACAGTGGGTC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 1179431995 21:41327956-41327978 CTCTTCACCCTCCAGCTGAGAGG 0: 1
1: 0
2: 1
3: 26
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179431991 Original CRISPR GACCCACTGTGCATGCTGAC AGG (reversed) Intronic
900604824 1:3519248-3519270 GACCCACTGGCCAAGGTGACAGG + Intronic
905838661 1:41153668-41153690 CACCCACTGTGATGGCTGACTGG + Intronic
912380507 1:109245552-109245574 GAGCCACTGTGCCTGGTGTCTGG - Intergenic
912993134 1:114509332-114509354 AACCCACTGTGAATGCTGGGAGG + Intronic
913411984 1:118562230-118562252 GCCCCAGTGTGTATGCTGTCTGG + Intergenic
914868416 1:151452579-151452601 GAGCCACTGCGCCTGGTGACAGG - Intronic
915301310 1:154953140-154953162 AAGCCACTGTGCATGCTGGGTGG - Intronic
915462359 1:156077595-156077617 GAACCAGTGTTCATGGTGACAGG - Exonic
916466177 1:165076584-165076606 GACCCACTGGGCATGTTGAGGGG - Intergenic
917493403 1:175517859-175517881 TACCCACTGTGCATGTTTCCAGG + Intronic
922119220 1:222646129-222646151 GAGCCACTGTGCCGGCTGACTGG - Intronic
923296802 1:232602273-232602295 GACCTACAGTCCATGCTGAGGGG + Intergenic
1062816815 10:506913-506935 CACCCACTGTGCATGATCAGAGG + Intronic
1062937838 10:1401204-1401226 GACCCACTGTGGAGGCAGCCGGG + Intronic
1064136930 10:12758983-12759005 ATCCCACTGGGCATGCTCACTGG + Intronic
1064166851 10:12994058-12994080 GATCCACTGTCCAAGCTGAATGG + Intronic
1065427490 10:25620196-25620218 GACCCCCCGTGTATCCTGACTGG + Intergenic
1067107188 10:43374254-43374276 GCTCCTGTGTGCATGCTGACTGG - Intronic
1067688864 10:48487780-48487802 GAGCCACTGTGCCTGGTGCCTGG - Intronic
1070190793 10:74110195-74110217 GCCCCACTGTGCATGGGGAGTGG + Intronic
1075038053 10:119085804-119085826 GAGCAACTGTGCTTGCTGAAGGG + Intergenic
1081736564 11:45408571-45408593 GACTCACTGATCATGCAGACAGG + Intergenic
1083178771 11:60971128-60971150 GCCCCACTGTGCCATCTGACGGG + Intergenic
1083406861 11:62463598-62463620 ATCCCACTGTGCGTGCTGTCAGG + Intronic
1084474544 11:69381301-69381323 GAACCATTGGGCATCCTGACTGG - Intergenic
1087484913 11:98748586-98748608 GACCCCCGGTGTATGCAGACTGG + Intergenic
1089508510 11:118980581-118980603 GCCCCGCCCTGCATGCTGACAGG - Exonic
1090207144 11:124891646-124891668 CCCCCACTGAGCATGCTCACAGG + Exonic
1094453367 12:30604839-30604861 GACCCCCCGTGTATCCTGACTGG + Intergenic
1094871842 12:34603163-34603185 GACACTCTGTGAATGCTAACAGG - Intergenic
1099490016 12:83276691-83276713 GACCCCCCGTGTATGCAGACTGG - Intergenic
1099988770 12:89700183-89700205 AATCCACTGTGCATGCAGAAAGG + Intronic
1102533253 12:113562249-113562271 TACCAACTGAGCATGGTGACTGG - Intergenic
1102624158 12:114220940-114220962 AACCCACTGTGCATGAAAACTGG - Intergenic
1105539906 13:21307393-21307415 CAGACACTGGGCATGCTGACAGG + Intergenic
1106121668 13:26864607-26864629 GTTGCAGTGTGCATGCTGACTGG - Intergenic
1112679044 13:101740991-101741013 GAACCACTTTGCTTACTGACCGG - Intronic
1112961218 13:105129140-105129162 AAGCCATTGTGCATGCTAACGGG - Intergenic
1116406054 14:44567781-44567803 GTCCCACTCTGCAGGCTGCCTGG + Intergenic
1116792458 14:49354013-49354035 GACCCCCCGTACATCCTGACAGG - Intergenic
1117301886 14:54438262-54438284 GAGCCACTGTGCCTGGTCACAGG + Intronic
1117843874 14:59890871-59890893 GACCTGCTGGGCATGCTGCCAGG + Intergenic
1121087504 14:91157714-91157736 CACCCACCGTGCATGCTGGGAGG - Intronic
1124210291 15:27757817-27757839 GCCCCAAAGTGCATGTTGACTGG + Intronic
1125041113 15:35188381-35188403 AGGCCACTGTGCATGCAGACAGG + Intergenic
1126866485 15:52942751-52942773 AATCCACTGTGGATTCTGACTGG + Intergenic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1133091656 16:3409087-3409109 GCCCAACCGTGCATGATGACAGG + Exonic
1136548038 16:30966236-30966258 GGCCCACGGTGCCTGCTGTCGGG - Exonic
1139563201 16:67756796-67756818 GACCCACAGTGAGTGATGACTGG - Intronic
1140947610 16:79784568-79784590 GAACCACTGTGCATGTGGCCAGG + Intergenic
1141785969 16:86201149-86201171 TAACCACTGTGCATACTGCCTGG + Intergenic
1142183986 16:88685880-88685902 GACCCCCGGAGCATGCTGACTGG - Intronic
1145263198 17:21366722-21366744 GCCCCACTGCCCATGGTGACAGG + Intergenic
1147350687 17:39840831-39840853 GACACACTCTTCATGCTGGCTGG - Intronic
1147991957 17:44339475-44339497 GACCCACTGTGCCTGCCTGCTGG + Intergenic
1148130276 17:45258036-45258058 GACCCACCTTGCATGATGGCAGG - Intronic
1151213510 17:72561950-72561972 GACCCACTGGGCATGGTGGTGGG + Intergenic
1151440696 17:74126989-74127011 GACCCACTGTAGATAGTGACAGG - Intergenic
1153951591 18:10062259-10062281 GATCCACAGAGCATGTTGACCGG + Intergenic
1156645080 18:39151414-39151436 GACCCACTGCTCTTGCTGGCAGG - Intergenic
1161455849 19:4369458-4369480 GACCCAGTGTGCAGGCTGGCAGG + Intronic
1163043513 19:14621166-14621188 GAGCCACTGGGCATGGTGGCAGG - Intronic
926782265 2:16484302-16484324 GACCTACTGAGCAAGCAGACAGG - Intergenic
927958741 2:27226152-27226174 GACCCACTGGGCATCCACACTGG + Exonic
928182006 2:29074627-29074649 AACACACTGTGAGTGCTGACTGG - Intergenic
928688799 2:33777416-33777438 GAACAACTGTACATGCTGAGAGG - Intergenic
929440482 2:41962426-41962448 AACCAACAGTGCATGCTCACAGG - Intergenic
930516055 2:52409604-52409626 GCCCCACCGTGTATCCTGACTGG - Intergenic
931289023 2:60856225-60856247 CAGCCAGTGTCCATGCTGACTGG + Intergenic
932051870 2:68405879-68405901 GCCCCCCTGTGCCTCCTGACTGG + Intergenic
933523836 2:83410444-83410466 GGCCCACTGTGAATACTGCCTGG + Intergenic
934577188 2:95410463-95410485 GGCCCACTGTCCATGCTGAGAGG - Intronic
937353676 2:121184880-121184902 CACCCACTGTGGAAGCTGAAGGG - Intergenic
939377721 2:141391433-141391455 GACACACAGTGCAGGCTTACAGG + Intronic
939393152 2:141594097-141594119 GACTCAGAGTGCATGCTGATTGG - Intronic
945490217 2:210446144-210446166 GCCCCCCTGTGCTTCCTGACTGG + Intronic
946178671 2:217937332-217937354 GACCCACTGTGGACGCTGTGCGG - Intronic
946415974 2:219539867-219539889 GACACACTGTTCCTGCTGGCCGG - Exonic
946612942 2:221478751-221478773 GACACTCTGTGCAGGCAGACAGG - Intronic
946882269 2:224188328-224188350 GAATCCCTGTGCATGCTGCCTGG - Intergenic
1175408217 20:58748842-58748864 GAACCATAGTTCATGCTGACAGG + Intergenic
1177358391 21:20037850-20037872 GGCGCACTGTGCAAGCTGTCAGG - Intergenic
1179306787 21:40161174-40161196 GACCCTTTGTGCATGCAGGCTGG + Intronic
1179431991 21:41327915-41327937 GACCCACTGTGCATGCTGACAGG - Intronic
1182515728 22:30857868-30857890 GACCCACAGTGCCTGCTGAGGGG - Intronic
1185310228 22:50150260-50150282 GCCCCACAGTGCCTGGTGACTGG - Intronic
950611652 3:14130879-14130901 GCCACACTGTGGATGCTGTCGGG - Exonic
950964130 3:17134384-17134406 CACCCACAGGGCATGCTGCCTGG + Intergenic
951993374 3:28700704-28700726 GTCCCACGGTCCCTGCTGACAGG - Intergenic
957588183 3:82159675-82159697 GCATCACTGTGCATGCTGCCTGG + Intergenic
958742861 3:98095845-98095867 GACCCCCTGTGTATCCTGACTGG - Intergenic
962811016 3:138959660-138959682 GCCCCACTGGGCATGGTGAAGGG + Intergenic
964384203 3:156129958-156129980 GATCCACTGTGCATGGAGAGAGG - Intronic
968900842 4:3431013-3431035 GGCCCACTGTCCTTTCTGACTGG - Intronic
972254136 4:37335269-37335291 CACCCACTGTGCCCTCTGACTGG + Intronic
976214893 4:82706812-82706834 GACACACTGTGCAGGCTCCCAGG - Intronic
977897759 4:102383766-102383788 GATCCCCTGTGCCTCCTGACTGG - Intronic
978664355 4:111164715-111164737 GACCCCCCGTGCCTCCTGACTGG + Intergenic
980496608 4:133592731-133592753 GAGCCAGTGTGGATGCTGGCAGG - Intergenic
980712782 4:136591686-136591708 GACCCACAGTGAATACTGCCTGG - Intergenic
984872117 4:184334993-184335015 GACAAGCTGTGCATGATGACAGG - Intergenic
985523332 5:389295-389317 CACGCACTGTGGATGCTGCCTGG - Intronic
986025011 5:3842698-3842720 CACCCACTGTGCTTGCTGTCGGG - Intergenic
990707849 5:58549865-58549887 GAGCCACTGTGCCTGCCGAAAGG - Intronic
1000905665 5:166963070-166963092 CACCCACTCCGCATTCTGACAGG - Intergenic
1001790146 5:174449336-174449358 GAGCCACTGTGCCTGCTGCCTGG - Intergenic
1003051456 6:2784507-2784529 GACCCACTGAGTATGCTGCTTGG + Intronic
1007494540 6:42250623-42250645 AACCCTGTGTGCATGCTGAGTGG - Intronic
1017200730 6:151751854-151751876 AACCCACTCTGCATGGTTACAGG + Intronic
1017432537 6:154385215-154385237 GACTCACAGTGCATGCTGATTGG - Intronic
1018972671 6:168539526-168539548 GCCACACTGTGCATGGTGTCTGG + Intronic
1019477477 7:1251034-1251056 GCCCCACTCTGAATGCTGAGGGG + Intergenic
1020282279 7:6655754-6655776 CAGCCACTGTGCAAGCTGCCAGG - Exonic
1023327674 7:39077597-39077619 GACCCTGTGTGGATACTGACAGG + Intronic
1023665170 7:42515308-42515330 AACCCACTGGGCAGGCTGTCAGG + Intergenic
1031875832 7:127139972-127139994 GCCCCACTATGCTTGCTGGCTGG + Intronic
1035731808 8:1858829-1858851 GAAACACTGTGCAAACTGACAGG - Intronic
1038696189 8:29808636-29808658 GAGCCACCGTGCCTGGTGACTGG - Intergenic
1039881909 8:41630457-41630479 GGCCCACTGGGCCTGCAGACAGG - Intergenic
1049308750 8:141922230-141922252 GACGCACTGTGCACGCAGCCCGG - Intergenic
1049384955 8:142338483-142338505 GGACCACTGGGCAAGCTGACAGG + Intronic
1049384966 8:142338541-142338563 GGACCACTGGGCAAGCTGACAGG + Intronic
1049384977 8:142338599-142338621 GGACCACTGGGCAAGCTGACAGG + Intronic
1053358880 9:37468846-37468868 GGCCCACTCTTCATGCTGACTGG + Intergenic
1056779378 9:89538117-89538139 GACTCACTGTGCCTGCAGGCTGG - Intergenic
1059698269 9:116749340-116749362 GACAAATTGTGCATGCTGTCAGG - Intronic
1189563465 X:42215034-42215056 GACCCTCTGTATATGGTGACTGG + Intergenic
1194242629 X:91470472-91470494 GACCCCCTGTGCCTCCTGACTGG + Intergenic
1195003904 X:100668472-100668494 GAGTCACTATGCTTGCTGACAGG - Intronic
1196803877 X:119567828-119567850 GAGCCACTGTTCTTGCTGAAAGG + Intergenic
1196898047 X:120357403-120357425 GAGCCACTGTGATTTCTGACTGG + Intergenic
1202057257 Y:20848110-20848132 GACCCACTGTGTATCCAGACTGG - Intergenic