ID: 1179433626

View in Genome Browser
Species Human (GRCh38)
Location 21:41344403-41344425
Sequence CAGGCGAAGACTTCGCGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179433626 Original CRISPR CAGGCGAAGACTTCGCGGAG CGG Intronic
913671086 1:121097762-121097784 CCGGCCAAGCCTCCGCGGAGAGG + Intergenic
922116257 1:222617715-222617737 GAGGAGAAGGCTTCGAGGAGAGG + Intergenic
1067841087 10:49679898-49679920 CTGGGGAAGACTTCCTGGAGAGG - Intronic
1070495768 10:77020616-77020638 CATGTGAAGAGTTGGCGGAGGGG - Intronic
1091207663 11:133832767-133832789 CAGGGCAGGACTTCGCGGGGCGG - Intergenic
1094806357 12:34097600-34097622 AAGGAGAAGACTTCTCGGACTGG - Intergenic
1102600505 12:114026162-114026184 CAGGCCCAGCCTTCGGGGAGGGG + Intergenic
1108603157 13:52011940-52011962 CAGGCGCAGAGTCCGAGGAGGGG - Intergenic
1128258042 15:66212650-66212672 CAGGCAAAGACTTGGCAGTGGGG - Intronic
1132784456 16:1647864-1647886 CAGGCTAAGACTTCCCAGATAGG - Intronic
1132904139 16:2273576-2273598 GAGGGGAAGACCTCGCGGTGGGG - Intergenic
1136026604 16:27472714-27472736 CAGGCAAAGATTTAGGGGAGCGG - Intronic
1144705764 17:17366926-17366948 CAGGGGAAGTCTTCGGGCAGAGG + Intergenic
1144871977 17:18377448-18377470 CAGGCGCAGGCTCAGCGGAGAGG - Intergenic
1147184188 17:38704936-38704958 GAGACGAAGACTTGGCGGAGGGG + Intergenic
1149506560 17:57198840-57198862 CAAGAGAAGACTTCAGGGAGAGG + Intergenic
1150668666 17:67170248-67170270 CAGGCGGAGACTTGGTGCAGAGG - Intronic
925060319 2:885628-885650 CAGGGGAAGACTAGGCGGACTGG + Intergenic
926027178 2:9555631-9555653 CAGGCGAAGGCTGCCCAGAGAGG - Exonic
1176410124 21:6445251-6445273 CAGGCAATGACTGCGCAGAGTGG - Intergenic
1179433626 21:41344403-41344425 CAGGCGAAGACTTCGCGGAGCGG + Intronic
1179685617 21:43053573-43053595 CAGGCAATGACTGCGCAGAGTGG - Exonic
1183805122 22:40202757-40202779 CAGGAGTAGACTGCGTGGAGGGG + Intronic
955325865 3:58009009-58009031 CAGGGGAAGACACCGGGGAGGGG - Intronic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
968160501 3:196423076-196423098 CAGGCGAGGACTTGGCGGGCTGG - Intronic
987371437 5:17196885-17196907 CAGGGGAAGACTTTGTGGAGTGG - Intronic
995850084 5:116535646-116535668 CAGGCTAAGACTGAGCTGAGGGG + Intronic
1004704555 6:18112213-18112235 CAGGGGAAGACTTGGCGATGGGG - Intergenic
1006401974 6:33822917-33822939 CAGGTGCAGACATCCCGGAGAGG - Intergenic
1008659675 6:53652897-53652919 CAAGAGAAGACTTTGCTGAGTGG - Intronic
1029189201 7:98759954-98759976 CAGGCAAAGCCTTCATGGAGGGG + Intergenic
1030991238 7:116302990-116303012 AAGGCAAAGATTTCGGGGAGAGG + Intronic
1035228286 7:157445502-157445524 CAGGCAAAGGCTTCGGGGAAGGG + Intergenic
1059322495 9:113480585-113480607 CCAGGGAAGACTTGGCGGAGGGG + Intronic
1061865357 9:133489303-133489325 CAGGCCAAGCCCTCGCAGAGAGG + Intergenic
1189202548 X:39210028-39210050 AAGGCGAAGACTTTGCAGACAGG - Intergenic
1196477692 X:116107998-116108020 CAGCCAAATACTTCGAGGAGAGG - Intergenic