ID: 1179435305

View in Genome Browser
Species Human (GRCh38)
Location 21:41358549-41358571
Sequence CTTGGCTCTCAGCAGTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179435305_1179435307 -6 Left 1179435305 21:41358549-41358571 CCTGATGACTGCTGAGAGCCAAG No data
Right 1179435307 21:41358566-41358588 GCCAAGCAGTGCTCTGGCCCAGG No data
1179435305_1179435310 -2 Left 1179435305 21:41358549-41358571 CCTGATGACTGCTGAGAGCCAAG No data
Right 1179435310 21:41358570-41358592 AGCAGTGCTCTGGCCCAGGGAGG No data
1179435305_1179435309 -5 Left 1179435305 21:41358549-41358571 CCTGATGACTGCTGAGAGCCAAG No data
Right 1179435309 21:41358567-41358589 CCAAGCAGTGCTCTGGCCCAGGG No data
1179435305_1179435316 30 Left 1179435305 21:41358549-41358571 CCTGATGACTGCTGAGAGCCAAG No data
Right 1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG No data
1179435305_1179435315 29 Left 1179435305 21:41358549-41358571 CCTGATGACTGCTGAGAGCCAAG No data
Right 1179435315 21:41358601-41358623 CCAGCCTGCAAGCCCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179435305 Original CRISPR CTTGGCTCTCAGCAGTCATC AGG (reversed) Intergenic
No off target data available for this crispr