ID: 1179435308

View in Genome Browser
Species Human (GRCh38)
Location 21:41358567-41358589
Sequence CCCTGGGCCAGAGCACTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179435308_1179435321 27 Left 1179435308 21:41358567-41358589 CCAAGCAGTGCTCTGGCCCAGGG No data
Right 1179435321 21:41358617-41358639 GCCCTGGGCAGAGGCCCCTCAGG No data
1179435308_1179435318 18 Left 1179435308 21:41358567-41358589 CCAAGCAGTGCTCTGGCCCAGGG No data
Right 1179435318 21:41358608-41358630 GCAAGCCCTGCCCTGGGCAGAGG No data
1179435308_1179435315 11 Left 1179435308 21:41358567-41358589 CCAAGCAGTGCTCTGGCCCAGGG No data
Right 1179435315 21:41358601-41358623 CCAGCCTGCAAGCCCTGCCCTGG No data
1179435308_1179435323 28 Left 1179435308 21:41358567-41358589 CCAAGCAGTGCTCTGGCCCAGGG No data
Right 1179435323 21:41358618-41358640 CCCTGGGCAGAGGCCCCTCAGGG No data
1179435308_1179435316 12 Left 1179435308 21:41358567-41358589 CCAAGCAGTGCTCTGGCCCAGGG No data
Right 1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179435308 Original CRISPR CCCTGGGCCAGAGCACTGCT TGG (reversed) Intergenic
No off target data available for this crispr