ID: 1179435316

View in Genome Browser
Species Human (GRCh38)
Location 21:41358602-41358624
Sequence CAGCCTGCAAGCCCTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179435308_1179435316 12 Left 1179435308 21:41358567-41358589 CCAAGCAGTGCTCTGGCCCAGGG No data
Right 1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG No data
1179435305_1179435316 30 Left 1179435305 21:41358549-41358571 CCTGATGACTGCTGAGAGCCAAG No data
Right 1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG No data
1179435312_1179435316 -5 Left 1179435312 21:41358584-41358606 CCAGGGAGGAGCATCACCCAGCC No data
Right 1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG No data
1179435311_1179435316 -4 Left 1179435311 21:41358583-41358605 CCCAGGGAGGAGCATCACCCAGC No data
Right 1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179435316 Original CRISPR CAGCCTGCAAGCCCTGCCCT GGG Intergenic
No off target data available for this crispr