ID: 1179435503

View in Genome Browser
Species Human (GRCh38)
Location 21:41359610-41359632
Sequence CCTGTCACGGGGCGGGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179435503_1179435518 27 Left 1179435503 21:41359610-41359632 CCTCACACCCGCCCCGTGACAGG No data
Right 1179435518 21:41359660-41359682 GGTGAGGCACAGAGAGGCTAAGG No data
1179435503_1179435513 2 Left 1179435503 21:41359610-41359632 CCTCACACCCGCCCCGTGACAGG No data
Right 1179435513 21:41359635-41359657 CATGATGATTTAACCTAGTGGGG No data
1179435503_1179435512 1 Left 1179435503 21:41359610-41359632 CCTCACACCCGCCCCGTGACAGG No data
Right 1179435512 21:41359634-41359656 TCATGATGATTTAACCTAGTGGG No data
1179435503_1179435514 6 Left 1179435503 21:41359610-41359632 CCTCACACCCGCCCCGTGACAGG No data
Right 1179435514 21:41359639-41359661 ATGATTTAACCTAGTGGGGCTGG No data
1179435503_1179435515 11 Left 1179435503 21:41359610-41359632 CCTCACACCCGCCCCGTGACAGG No data
Right 1179435515 21:41359644-41359666 TTAACCTAGTGGGGCTGGTGAGG No data
1179435503_1179435517 21 Left 1179435503 21:41359610-41359632 CCTCACACCCGCCCCGTGACAGG No data
Right 1179435517 21:41359654-41359676 GGGGCTGGTGAGGCACAGAGAGG No data
1179435503_1179435511 0 Left 1179435503 21:41359610-41359632 CCTCACACCCGCCCCGTGACAGG No data
Right 1179435511 21:41359633-41359655 GTCATGATGATTTAACCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179435503 Original CRISPR CCTGTCACGGGGCGGGTGTG AGG (reversed) Intergenic
No off target data available for this crispr