ID: 1179437682

View in Genome Browser
Species Human (GRCh38)
Location 21:41373576-41373598
Sequence CTGTGGGGCTGAAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 721
Summary {0: 1, 1: 0, 2: 4, 3: 86, 4: 630}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179437682 Original CRISPR CTGTGGGGCTGAAGGGCAGA GGG (reversed) Intronic
900183773 1:1323920-1323942 CTGGGGGGCTGAGGGGCTGGGGG + Intronic
900183776 1:1323928-1323950 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183819 1:1324040-1324062 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183821 1:1324048-1324070 CTGGGGGGCTGAGGGACTGAGGG + Intronic
900183824 1:1324056-1324078 CTGAGGGACTGAGGGGCTGAGGG + Intronic
900183849 1:1324120-1324142 CTGCGGGGCTGAGGGGCTGGGGG + Intronic
900183857 1:1324136-1324158 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183862 1:1324144-1324166 CTGGGGGGCTGAGGGGCTGGGGG + Intronic
900183865 1:1324152-1324174 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183888 1:1324216-1324238 CTGCGGGGCTGAGGGGCTAAGGG + Intronic
900266941 1:1762154-1762176 TTGTGTGGCTGCTGGGCAGATGG - Intronic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
900555775 1:3279666-3279688 CTGTGCTGCAGGAGGGCAGAGGG + Intronic
900596725 1:3483359-3483381 CTGTGTGGATGCAGGGCAGTGGG + Intergenic
900760535 1:4467353-4467375 CAGAGGGGCTGCAGGGGAGAAGG + Intergenic
902242646 1:15099171-15099193 CTGGGAGGCTGATGGGCAGAGGG + Intronic
902439184 1:16418159-16418181 CTGTGGGGGAGAAGAGGAGAGGG - Intronic
902775360 1:18671124-18671146 CTGTGGGGCAGGAAGGCAGCAGG + Intronic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
902789444 1:18756713-18756735 GTGTGGGGGTGAGGGGTAGATGG + Intergenic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
902917417 1:19646953-19646975 CTGTGGGAGCGAGGGGCAGAAGG + Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
903764163 1:25722780-25722802 ATGTGGGGCAGAAGAGAAGATGG + Intronic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
904260412 1:29284542-29284564 CTGTGGCGTGGAAGTGCAGAAGG + Intronic
904303869 1:29574322-29574344 TTGTGGGGCTGAAGGCCTCAGGG + Intergenic
904311583 1:29632781-29632803 CTGGAGGGCTGAGGGGAAGAGGG - Intergenic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904311603 1:29632828-29632850 CTGAGGGGCTGAGGGGCTGGGGG - Intergenic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
906203899 1:43976766-43976788 CTGTGGCACTGAAAGGCTGAGGG - Exonic
907045660 1:51298645-51298667 TTGTGTGGCAGAAGGGCAGGGGG - Intronic
907267620 1:53272424-53272446 CTGGGGGGCAGAGGGGGAGAGGG - Intronic
907458514 1:54591617-54591639 CTGTGGGGAGGAGGGGCAGGAGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907527654 1:55063261-55063283 CTGTGAGGCCAAAGTGCAGACGG - Intronic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907823942 1:57997497-57997519 CTGAGGGGCTATAAGGCAGAGGG - Intronic
911533583 1:99075091-99075113 CTGTGGGGCGGCCTGGCAGAGGG - Intergenic
911728230 1:101264862-101264884 GGGTGGGGCTGAAGGTCAAAAGG - Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912775765 1:112505576-112505598 TTGTGGGGCTGCCAGGCAGAGGG - Intronic
913531715 1:119738372-119738394 GTGTGGGGCTGCTGGGCAGCAGG - Intronic
913593848 1:120354692-120354714 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
913645625 1:120851246-120851268 GGGTGGGGCGGAAGAGCAGACGG - Intergenic
914005615 1:143729857-143729879 CTGAGCGGCAGAAAGGCAGACGG - Intergenic
914081087 1:144412280-144412302 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
914093407 1:144524294-144524316 GGGTGGGGCGGAAGAGCAGACGG - Intergenic
914096278 1:144546810-144546832 GGGTGGGGCGGAAGAGCAGAAGG - Intergenic
914098081 1:144561103-144561125 CTGAGCGGCAGAAAGGCAGACGG - Intergenic
914176002 1:145280814-145280836 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
914267759 1:146052521-146052543 CTGAGCGGCAGAAAGGCAGACGG - Intergenic
914300901 1:146376512-146376534 CTGAGCGGCAGAAAGGCAGACGG + Intergenic
914302238 1:146387153-146387175 GGGTGGGGCGGAAGAGCAGAAGG + Intergenic
914305121 1:146409608-146409630 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
914513765 1:148356065-148356087 CTTTGGGGAAGAAGGGCAGGGGG - Intergenic
914596937 1:149163217-149163239 GGGTGGGGCGGAAGAGCAGACGG - Intergenic
914928614 1:151909771-151909793 CTGAGGGGCTGAGGGGCCCAAGG - Exonic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
916142681 1:161712967-161712989 CTGTGGGGCCCAATGGCAGCAGG - Intronic
916159754 1:161897484-161897506 CTTTGGTGCTGAAGGTTAGAAGG - Intronic
916256673 1:162794926-162794948 CAGTGAGGCTGTGGGGCAGAAGG + Intronic
917535734 1:175873072-175873094 GTGGGGGGCTGAAGGGAGGAGGG - Intergenic
917537263 1:175883511-175883533 CTATGGGGCTAAAGGGATGAGGG - Intergenic
918340851 1:183566985-183567007 CTGTGGTGCTGCACTGCAGAAGG - Exonic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919745029 1:201003505-201003527 GGGTGAGGCTGCAGGGCAGAGGG + Intronic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
919887857 1:201947838-201947860 TGGGGGGACTGAAGGGCAGAAGG + Intergenic
919919769 1:202160987-202161009 CTGTGGGGCAGAAGCAGAGAAGG - Exonic
920039260 1:203085266-203085288 CAGTGGGGAGGAAGTGCAGAAGG - Intronic
920383766 1:205552384-205552406 CTATGTGGCGGAAGGGCAGAGGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
921761419 1:218919465-218919487 CTGTGTGGCTGAGAGGCAGGAGG - Intergenic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
922618309 1:226976268-226976290 CTGCGGGGCTGCAGGGCTGCGGG + Intronic
922790054 1:228306357-228306379 CTGTGGGGCTGCAGGGGGCAGGG - Exonic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924027462 1:239850323-239850345 CTGAGTGGCTGAAGAGGAGAAGG + Intronic
924139865 1:241011266-241011288 CTTGGGGACTGAAAGGCAGAAGG + Intronic
924257386 1:242195935-242195957 GTGAGGGGCTGAAGAGAAGAGGG + Intronic
1062833790 10:623448-623470 CTGTGGGGCTGAGGGGAGGAGGG + Intronic
1064102154 10:12473088-12473110 ATGTGGGGCAGGAGGGGAGAGGG + Intronic
1064717634 10:18193390-18193412 CTGTGGGTGTGAAGTGCAGGTGG + Intronic
1065738068 10:28771968-28771990 CTGGGCGGCTGCAGGGCAGAGGG - Intergenic
1066723134 10:38360583-38360605 CAGTGAGGCTGTGGGGCAGAAGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067183257 10:44006136-44006158 ATTTGGGGCTGATGGGCAGTGGG - Intergenic
1067225089 10:44370725-44370747 CAGAGGGGCTGAATAGCAGAAGG - Intronic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1068443450 10:57089754-57089776 CTGAGGGAGTGAAGGGCTGATGG + Intergenic
1069157957 10:65053581-65053603 GTGAGGGGCTGAAAGGCTGAAGG - Intergenic
1069732989 10:70631258-70631280 CTGGGCGGCTGCCGGGCAGAGGG - Intergenic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070722964 10:78769447-78769469 TGGTGGGGCTGAAGGAAAGAAGG - Intergenic
1071102387 10:82054209-82054231 CTGTGGTGCAGTAAGGCAGAAGG + Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071571574 10:86700195-86700217 CTGTGGGGCAGGAGAGCAGCAGG - Intronic
1071852732 10:89591667-89591689 CTGTGGGGCTGAATGAGTGAAGG - Intronic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1073295533 10:102436182-102436204 ATGTGGGGCTGGAGGGGTGAGGG - Intergenic
1073300879 10:102470423-102470445 CTGTTGGGCTGATGGCCAAAGGG - Intronic
1075397984 10:122141499-122141521 CTGTGGGTGTTAAGGGCAGGCGG + Intronic
1075657980 10:124174428-124174450 CTTTGGGGCTGGAGGGCACTGGG - Intergenic
1075951418 10:126481006-126481028 CAGTGGGACTGCAGAGCAGAGGG - Intronic
1076193773 10:128500567-128500589 CTGGGGGGCAGAGGGGCAGGAGG + Intergenic
1076207172 10:128612522-128612544 CTGTGGGGCTGAGCCGCATAGGG + Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076623796 10:131809395-131809417 CACTGGGGGTGAATGGCAGATGG - Intergenic
1077187933 11:1243765-1243787 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077188360 11:1245436-1245458 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077188890 11:1247536-1247558 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077189315 11:1249207-1249229 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077269590 11:1669224-1669246 CTGTGGGGCACACGGGAAGAGGG + Intergenic
1077326680 11:1967013-1967035 CTGGGGGGCTGCAGGGCCGCCGG + Intronic
1077334757 11:1998289-1998311 GTGGGGTGCTGAGGGGCAGAGGG + Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077870862 11:6260225-6260247 CTGTGGGGGTGAAGGTGTGAGGG - Intronic
1077920159 11:6635988-6636010 CTTTGGGGCAGAATGGGAGAGGG - Intronic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1079007282 11:16800846-16800868 ATCTGGGGCTGAGGGGGAGAAGG + Intronic
1080986811 11:37477517-37477539 GTCTGGGGCTGACAGGCAGAGGG - Intergenic
1081750227 11:45505361-45505383 CTTTGGGGCTGAGGGGCACTGGG - Intergenic
1081752538 11:45522194-45522216 CTGTGGGACTGAAAGTCAGGTGG - Intergenic
1082059315 11:47847117-47847139 CTGTGTGGCTTAAGTGCAGTGGG - Intronic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1083160235 11:60850033-60850055 AAGTGGGGCAGAAGGGCAGAGGG - Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083311459 11:61786008-61786030 CTCTGGGGGTGCGGGGCAGATGG - Intronic
1083493551 11:63030919-63030941 CTGGGGGGCTGTGGGGGAGACGG + Intergenic
1083593875 11:63909948-63909970 CTCTGGGGAGGAGGGGCAGAGGG - Exonic
1083621158 11:64050104-64050126 CTGTGGGGCATAAGGACCGAGGG - Intronic
1083712116 11:64555892-64555914 CTGAGGGGCAGGAAGGCAGAAGG + Exonic
1083812405 11:65113010-65113032 CTGTGGGGACGAGGGGCATAGGG - Intronic
1083827764 11:65212796-65212818 GTGAGGGGCTGGAGGGCAGGAGG + Intergenic
1083945676 11:65921315-65921337 TCGGGGGGCTGCAGGGCAGAAGG - Exonic
1083989532 11:66238352-66238374 CTCTGGGGATAAAGGGCTGAAGG - Intronic
1084413048 11:69014992-69015014 CAGTGGGGCAGCAGGGCAGGGGG + Intergenic
1084418484 11:69048719-69048741 TTCTGGGGCTTAAGGGCCGAGGG - Intergenic
1084480040 11:69414864-69414886 CTGTGGAGCTGTTGGGGAGAAGG + Intergenic
1084548759 11:69828232-69828254 CTTGGGGTCTGATGGGCAGACGG + Intergenic
1084966499 11:72747318-72747340 GTGTGGGGCTCAGGGTCAGAGGG - Intronic
1085052981 11:73389221-73389243 CTGGAGGGCTGCAGGGCTGAGGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1088196407 11:107278787-107278809 CTGTGGGGATGATGGGCTCATGG + Intergenic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1089364127 11:117910648-117910670 GTGTGGGAGTAAAGGGCAGAGGG - Intronic
1089462425 11:118660999-118661021 CTGTGGGGCCCAAGGGCAGCTGG - Intronic
1089604291 11:119632792-119632814 CTGTGGGGGTGAAGGCCAACTGG + Intronic
1089744202 11:120605718-120605740 CAGCGTGGCTGAAGGGCAGGGGG - Intronic
1090596544 11:128326977-128326999 CTGAGGGGCAGCCGGGCAGAAGG - Intergenic
1090694479 11:129224560-129224582 CTGTGGAGCTGCAGATCAGAGGG - Intronic
1091080142 11:132658623-132658645 CTCAGCGGCTAAAGGGCAGATGG - Intronic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1202809661 11_KI270721v1_random:22193-22215 CTGGGGGGCTGCAGGGCCGCCGG + Intergenic
1202817740 11_KI270721v1_random:53471-53493 GTGGGGTGCTGAGGGGCAGAGGG + Intergenic
1091763757 12:3104925-3104947 GTGTGGGGGTGATGGGCAGGGGG + Intronic
1091903404 12:4163981-4164003 CTGTGGAGCTGAAGGAGACAAGG + Intergenic
1092090698 12:5801500-5801522 CTGTAGGGCTGATGTTCAGATGG - Intronic
1092230511 12:6773253-6773275 TTGTGGGGCTGCAGGGGAGCTGG - Exonic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094693629 12:32794871-32794893 GAGTGGGGCTGCAGAGCAGAAGG + Intronic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1095942510 12:47736273-47736295 CCATGGGGCTGAAGTGCAGAGGG + Intronic
1096650678 12:53060652-53060674 CTGTAGGGTGGAAGGGCAGATGG - Intronic
1096740068 12:53686714-53686736 CTGTTGGCCTGTAGTGCAGATGG - Intergenic
1097160951 12:57046428-57046450 CTGGGAGGCTCAAGGGAAGAGGG + Intronic
1097180574 12:57169373-57169395 CCGTGGGTCTGAAAGACAGATGG - Intronic
1102612509 12:114124852-114124874 CTGAGGCTCAGAAGGGCAGATGG - Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103765221 12:123274994-123275016 CTGAGGTGCTGAGGGGCTGAGGG + Intergenic
1103765225 12:123275010-123275032 CTGAGGGGCTGAGGTGCTGAGGG + Intergenic
1103765229 12:123275026-123275048 CTGAGGGGCTGAGGTGCTGAGGG + Intergenic
1103765232 12:123275034-123275056 CTGAGGTGCTGAGGGGCTGAGGG + Intergenic
1103765242 12:123275066-123275088 CTGAGGGGCTGAGGTGCTGAGGG + Intergenic
1103765258 12:123275114-123275136 CTGAGGGGCTGAGGTGCTGAGGG + Intergenic
1103765268 12:123275146-123275168 CTGAGGGGCTGAGGTGCTGAGGG + Intergenic
1103765277 12:123275170-123275192 CTGGGGTGCTGAGGGGCTGAGGG + Intergenic
1103765286 12:123275210-123275232 CTGAGGTGCTGAGGGGCTGAGGG + Intergenic
1103765289 12:123275218-123275240 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1103765292 12:123275226-123275248 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1103909774 12:124345824-124345846 CTGTGGGGCTGTGAGGCGGAAGG - Intronic
1104531151 12:129572304-129572326 GTGTGGAGCTGGCGGGCAGAGGG + Intronic
1104928257 12:132324906-132324928 CTGTGGGGCTGGAGGGCTTGGGG - Intronic
1104963693 12:132499704-132499726 CTGGGGGGCTGCAGGGCTGGGGG + Intronic
1105847313 13:24304556-24304578 GTGGGGGGCTGCAGGGGAGAAGG - Exonic
1107058507 13:36131205-36131227 CTGCGGGGCTGCAGGGCTGGGGG + Exonic
1108640523 13:52378750-52378772 CCCTGGGGCTGAAGAGGAGATGG + Exonic
1108741285 13:53341349-53341371 CTGTGGGGCAGACGAGCAGCAGG - Intergenic
1110339304 13:74370313-74370335 GTCTGAGGCTGAAGGGCCGAGGG - Intergenic
1110702366 13:78563547-78563569 CTGTGGGAGGGAAGGGCTGATGG + Intergenic
1111154397 13:84303321-84303343 ATGTGGGGCAGAAGGGGAAAAGG + Intergenic
1111806738 13:93047815-93047837 TTGGGAGGCTGAAGGGCAGGTGG - Intergenic
1112972186 13:105273911-105273933 CTATGGGGCTGAAGAGCAGATGG - Intergenic
1113040740 13:106101495-106101517 CTGAGGGACTGAAGGAAAGAAGG - Intergenic
1113571689 13:111362444-111362466 GGCTGGGGCTGAAGGGCAGAGGG + Intergenic
1113671566 13:112178974-112178996 CTGTGAGGCTGTGGGGCAGTGGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1115271863 14:31561550-31561572 CCGTGGTGCTGCAGGGCAGGGGG + Intronic
1116041073 14:39686973-39686995 ACTTGGGGCTAAAGGGCAGACGG - Intergenic
1116149982 14:41128702-41128724 CTGGGGGGCTGGAGGGCTGGGGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118285587 14:64468460-64468482 TCCTGGGGCTGAAAGGCAGAAGG + Exonic
1119104053 14:71907404-71907426 CTGTGGGGCTGGGGCGTAGAAGG + Intergenic
1119532686 14:75374036-75374058 CTGTGGGGCTGAGGGGCTGTGGG + Intergenic
1119543784 14:75457405-75457427 CTGTGGGGCATGAAGGCAGAGGG + Intronic
1120039197 14:79733134-79733156 AGGTGGGGGTGAAGGGAAGATGG + Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1120923812 14:89778746-89778768 CAGTCTGGCTGAAGGGCGGAGGG - Intergenic
1121101791 14:91254427-91254449 CTGTGAGGATGTGGGGCAGAGGG - Intergenic
1121448547 14:93993608-93993630 ATTTGGGGCTGTAGAGCAGATGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121566117 14:94910445-94910467 CTGGGAGCCTGAAGGGGAGAGGG - Intergenic
1121733435 14:96202204-96202226 CTGTGGGGCTAAAGTACAGAGGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1124604552 15:31160854-31160876 CAGCTGGGCGGAAGGGCAGAGGG - Intronic
1125889988 15:43258710-43258732 CTGTGGTGCTGCAGGACAGGAGG - Intronic
1126850944 15:52796394-52796416 AGGTGGGGCTGCGGGGCAGATGG + Intergenic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1128217639 15:65945383-65945405 GTGTGGGGCTGCAGGCCTGAGGG + Intronic
1128621860 15:69157965-69157987 CTGTAGGGCTGAAGGGGCCATGG + Intergenic
1128657162 15:69470723-69470745 GGGTGGGGGTGAGGGGCAGAAGG - Intergenic
1128818842 15:70634264-70634286 AAGTGGGGATGAAGGGCGGATGG + Intergenic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1130135283 15:81176925-81176947 CTGAGGGGCTGGGGGGCACAAGG + Intronic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1130710417 15:86275163-86275185 TTTTGGTGCTGAAGGGCAGAGGG + Intronic
1132027942 15:98418859-98418881 CTGGAGTGCTGAAGGGCAAAGGG + Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132140068 15:99385037-99385059 CCTTGGGCCTGAAGGGCAAAGGG + Intronic
1132146577 15:99433071-99433093 CTGGGCAGCTGGAGGGCAGAAGG - Intergenic
1132421770 15:101676141-101676163 ACGATGGGCTGAAGGGCAGAGGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133232176 16:4372002-4372024 CTGTGGGGCTGGGGGGCTGCGGG + Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134042475 16:11079059-11079081 GTGTGGGGCTGCAGGGCTGCAGG - Intronic
1134461974 16:14437345-14437367 GTGGGCAGCTGAAGGGCAGAGGG + Intronic
1135359202 16:21796893-21796915 ATGTGGGGCAGAGGGGGAGAGGG + Intergenic
1135457754 16:22613330-22613352 ATGTGGGGCAGAGGGGGAGAGGG + Intergenic
1135505656 16:23033848-23033870 CAGTGGGTCTGAAAGGCACATGG - Intergenic
1136297508 16:29312095-29312117 CTGTGGGGCTGCAGGGCCTTGGG - Intergenic
1136407629 16:30057726-30057748 GTTTGGGGCTGAGGGGCAGAAGG + Intronic
1136407631 16:30057734-30057756 CTGAGGGGCAGAAGGGCAAAAGG + Intronic
1136417476 16:30112794-30112816 CTGTGGGGGTGAAGGTCAGCGGG + Intronic
1136619716 16:31420268-31420290 GTGTAGGGCTGAAGGCAAGAGGG + Intronic
1136777973 16:32881718-32881740 CGGTGGGGGTGATGGGCACAGGG + Intergenic
1136892649 16:33979796-33979818 CGGTGGGGGTGATGGGCACAGGG - Intergenic
1137003608 16:35252092-35252114 CCGTGGGGCAGATGGACAGAGGG - Intergenic
1137017897 16:35394531-35394553 CTGTGGGACAGATGGACAGAGGG - Intergenic
1137391654 16:48086367-48086389 CTGTCTGGCTGTAGAGCAGATGG - Intronic
1137478900 16:48834748-48834770 GTTTTGGGCTGAAGGGCAGAGGG + Intergenic
1137501263 16:49013351-49013373 CTGTGAGGCTGCAGCGCAGCCGG + Intergenic
1137539625 16:49353319-49353341 ATGTGGGGCTGCTGGGCAAATGG + Intergenic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1137792794 16:51188981-51189003 CTGTGGGGCTGAGGTGTAGATGG - Intergenic
1138086281 16:54136509-54136531 CTGGTGGACTGAAGGGGAGAGGG - Intergenic
1138089916 16:54165545-54165567 CCGCGGGGCTGAAGGACAGAAGG + Intergenic
1138414122 16:56861544-56861566 CAGTGGGGCTGAAGGCTTGAGGG - Intergenic
1138510932 16:57508089-57508111 CTGGAGGGCTGGAGTGCAGAGGG + Intergenic
1138569662 16:57861624-57861646 CTGGGGGCCAGAAGGGCAAAAGG + Intronic
1138584802 16:57962781-57962803 CTGAGGGGCTGAGGGGCTGCTGG - Intronic
1139371128 16:66470079-66470101 GAGTGAGGCTGAAGGTCAGAGGG + Intronic
1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG + Intronic
1141401242 16:83748896-83748918 CTGTAGGGCACAAGGGCAGAAGG + Intronic
1141493580 16:84391298-84391320 CTGTGGGGCTGAAGGGTCCGAGG - Intronic
1141569051 16:84923123-84923145 CTCTGGGGCTGATGGACAGCTGG - Intergenic
1141805525 16:86338937-86338959 CTTGGGGGCTGAATGCCAGAGGG - Intergenic
1142059064 16:88018172-88018194 CTGTGGGGCTGCAGGGCCTCGGG - Intronic
1142109936 16:88325843-88325865 AGATGGGGCTGCAGGGCAGAAGG + Intergenic
1142186575 16:88697689-88697711 CTGTGTGGGTGATGGGCAGAGGG - Intronic
1142249932 16:88986564-88986586 CTGTGGGGCTGTAGGGGGGCAGG - Intergenic
1142348203 16:89567607-89567629 CTGTGCCTCTGAAGGGCGGACGG + Intergenic
1203080391 16_KI270728v1_random:1143827-1143849 CGGTGGGGGTGATGGGCACAGGG + Intergenic
1142964499 17:3572270-3572292 CAGAGGAGCTGAGGGGCAGAGGG + Intronic
1143393578 17:6575104-6575126 CACTGGGGCTGCAGGGCAGATGG + Intergenic
1143393897 17:6576746-6576768 CAGTGGGTCTGAAAGGCAGAAGG - Intergenic
1143473702 17:7191589-7191611 CTCTGGGGCTGAAGGCTGGAAGG - Intronic
1143539097 17:7558940-7558962 CAGTGGTGCAGAAGGGAAGAAGG - Exonic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1143831285 17:9653698-9653720 GTTTGGGGCTGAACGACAGAGGG + Intronic
1144131501 17:12251142-12251164 CTGGGGGGATTAAGGGCAGGTGG + Intergenic
1144433017 17:15212514-15212536 CTGCAGGGGTGAAGGGGAGATGG + Intergenic
1144496612 17:15749832-15749854 CTGAGGGGCTGAAAGGCTGAGGG + Intergenic
1144496670 17:15750016-15750038 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1144496689 17:15750074-15750096 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1144606263 17:16667477-16667499 CTGAGGGGCTGAAAGGCTGAAGG + Intergenic
1144620714 17:16816765-16816787 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144794455 17:17881615-17881637 CTGTGGGCTTGACAGGCAGATGG - Intronic
1144904943 17:18634791-18634813 CTGAGGGGCTGAGGGGCTGAGGG - Intergenic
1145147293 17:20492995-20493017 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1145761973 17:27430322-27430344 GTCTGGGGCTGCAGGGCAGCTGG - Intergenic
1145965104 17:28911393-28911415 GTGTGGTGAGGAAGGGCAGATGG + Intronic
1146172074 17:30642006-30642028 CCCTGGGGCTGAGGGGCAAAGGG - Intergenic
1146615711 17:34355789-34355811 CTCTGGGCCTGAGGGGCAGAAGG + Intergenic
1146716254 17:35089217-35089239 CTCTGGGGCTGAGGGGCACCCGG + Exonic
1146883762 17:36457682-36457704 CTGTGGGGCTGACTCCCAGAAGG + Intergenic
1147363692 17:39946671-39946693 CTGGGGAGCAGAAGGGGAGATGG - Intergenic
1147370477 17:39989229-39989251 CAGTGGGGCTGAGGAGCAGGAGG - Intronic
1147444236 17:40465101-40465123 CTGGGTGGCTGCAGGGCTGAAGG + Intergenic
1147572104 17:41577663-41577685 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148205774 17:45778982-45779004 CTGGGGGGCTGCAGGGGAGGGGG - Intergenic
1148241821 17:46004202-46004224 CTGTGGGGCTGTGGGGCTGCAGG + Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1149544897 17:57496259-57496281 CTGTGGCTCTGTAGGGCACACGG - Intronic
1150247764 17:63689135-63689157 CTGTGGGGCAGAAGAGGACATGG - Intronic
1150295585 17:64005635-64005657 ATCTGGAGCTGATGGGCAGATGG - Intronic
1150618225 17:66788871-66788893 CTGTGGGCCTGAGGGGGAGAGGG + Exonic
1151194023 17:72419207-72419229 TTGTGGGTCTGAATGGGAGATGG + Intergenic
1151830144 17:76544679-76544701 CTGTCAGGCTGAGGGCCAGAGGG + Intronic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1152141287 17:78538307-78538329 CTGTGAGGCTGCAGGGCTGCAGG + Intronic
1152284316 17:79403519-79403541 CTGTGGAGCTGTGGGGCTGACGG - Intronic
1153092862 18:1368598-1368620 CTGTGGGGCAGAAAGTCAAAAGG + Intergenic
1153191777 18:2548825-2548847 CTGTGAGGTTGAAGGGTAAAGGG - Intronic
1154294753 18:13138313-13138335 CTGTGGGGCCGAAGGGAAACTGG - Intergenic
1154311025 18:13266281-13266303 ATGCAGGGCTGGAGGGCAGAGGG - Intronic
1156454717 18:37286549-37286571 CTGTGGGTCAGAGGGGCAGGGGG - Intronic
1157429779 18:47615219-47615241 CTATGGGGCTGCAGTGTAGAGGG + Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1158435087 18:57429898-57429920 CTATGGGGCTTTGGGGCAGAAGG + Intergenic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1160632368 18:80255524-80255546 TTGTGTGCCTGAAGGGCTGATGG + Intergenic
1160719876 19:592364-592386 CTGGGGGGCAGGTGGGCAGATGG + Intronic
1160744251 19:703456-703478 TTGTGGGGCTGCAGGGCACTGGG + Intergenic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG + Intronic
1161112730 19:2479098-2479120 CTTGGGGGCTGCAGGGCAGAGGG - Intergenic
1161124261 19:2546982-2547004 CTCGGGAGCTGAAGGGCAGGAGG + Intronic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1163218356 19:15897139-15897161 CTGCGGGGCTCCTGGGCAGAGGG - Intronic
1163847481 19:19645791-19645813 CTGTGGGGATGAGGGACAGATGG + Intronic
1165061643 19:33207736-33207758 CTGTGGGACTGAACGGCGGGGGG + Exonic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1166005174 19:39901858-39901880 CCGTGGGGCTGATGAGCAGTGGG + Intronic
1166191609 19:41180304-41180326 CTGGGTGGCTGCCGGGCAGAGGG - Intergenic
1166891732 19:45998231-45998253 TTGTGGCGCCCAAGGGCAGAAGG + Intronic
1167080085 19:47272209-47272231 CTCTGGGGCTGAGGGGCAGAGGG + Intergenic
1167720097 19:51173474-51173496 CTGTTGTTCTGAAGAGCAGAAGG + Intergenic
1202709483 1_KI270714v1_random:9706-9728 CTGAGCGGCAGAAAGGCAGACGG + Intergenic
925393096 2:3512432-3512454 CTGAGGCTCTGTAGGGCAGAGGG - Intronic
925451090 2:3969696-3969718 GTGGGGGGCAGCAGGGCAGAGGG - Intergenic
926756501 2:16240590-16240612 ATGTGGGGCTGAAGCACTGATGG + Intergenic
927428614 2:23007993-23008015 GGGTGGGGCTGAAGGGGAGAGGG + Intergenic
928209423 2:29312531-29312553 CTGTTGGGCTGTGGGGCAGGAGG + Intronic
928273972 2:29881993-29882015 CTGAGCTGCTGAAGGGCTGAGGG - Intronic
928622809 2:33108221-33108243 CTGGGGGGCTGTGGGGCAGAGGG + Intronic
928660851 2:33500451-33500473 CGGTGGAGATGAAGGGCAGTGGG + Intronic
928762917 2:34605825-34605847 AAGTGGGGCAGAAGGACAGAAGG + Intergenic
929262766 2:39884019-39884041 CTATGAGGCTGAAGGGAAGATGG + Intergenic
930296441 2:49560474-49560496 CTTAGGGGCTGAAGGGCACTAGG + Intergenic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
931624563 2:64245189-64245211 ATGTGGGACTGAAGGGAAGTTGG - Intergenic
932344734 2:70988256-70988278 CTGTGAAGCTTAAGAGCAGATGG - Exonic
932418584 2:71588217-71588239 CTGGGGGTCTGAATGGGAGAAGG + Intronic
932734958 2:74248037-74248059 GTCTTGGGCTGAAGGTCAGAAGG - Intronic
932824525 2:74927293-74927315 CTCTGGGGCTGAAGAACACAGGG - Intergenic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
934128182 2:88919806-88919828 CAGAGGGGCAGAGGGGCAGAGGG - Intergenic
934494847 2:94788086-94788108 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
936053009 2:109239806-109239828 CTGTGGGGATGAAAGGCAGGTGG - Intronic
936460549 2:112711184-112711206 CTGTGCTGCAGAAAGGCAGAAGG - Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
936919561 2:117673897-117673919 CTGTGGGGCAGAAGGAAATAGGG + Intergenic
936970183 2:118169494-118169516 CTGTGGAGCTCAGGGTCAGAGGG + Intergenic
937241456 2:120465082-120465104 CTGGGGGGCTCCATGGCAGAAGG - Intergenic
937658566 2:124404592-124404614 CTGAGTGGCAGAAGGGCAGGGGG + Intronic
937989195 2:127653065-127653087 ATGAAGGGCTGAGGGGCAGACGG - Intronic
938293413 2:130162243-130162265 CCGTGGTGCTGCAGGGCAGCAGG - Intronic
938310286 2:130285012-130285034 CTGAGGGGCAGGAAGGCAGAGGG - Intergenic
938444645 2:131367362-131367384 CTGAGGGGCAGAAAGGCAGAGGG + Intergenic
938540647 2:132281228-132281250 CCGTGGGGCTGCAGGGGAGGGGG + Intergenic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941724643 2:168848261-168848283 CTGGGAGACAGAAGGGCAGACGG + Intronic
942719953 2:178940147-178940169 CAGGAGGGCTGAATGGCAGAAGG + Intronic
943482016 2:188430637-188430659 CTGAGTGACAGAAGGGCAGAAGG - Intronic
943676455 2:190720454-190720476 CTGTCAGGATGAAGTGCAGAGGG + Intergenic
943701896 2:190996029-190996051 ATGTGGGGCAGAGGGGCAGGAGG + Intronic
943926132 2:193782890-193782912 CTGTCGGGGTGAGGGGCAGGGGG - Intergenic
945208999 2:207363127-207363149 CTGTGGGGGTGAAGTGGGGAGGG - Intergenic
946051919 2:216869931-216869953 CTGTGGGGCTCTAGGGGATAGGG + Intergenic
946420441 2:219561677-219561699 CTGTGAGGGCCAAGGGCAGAGGG - Intronic
946893862 2:224303159-224303181 CTGCTGGGCTAAAGGGCTGAAGG + Intergenic
947530646 2:230906876-230906898 CTGAGGGGCTGAAGAACTGAGGG - Intergenic
947998422 2:234547755-234547777 ATGAATGGCTGAAGGGCAGAAGG + Intergenic
948068095 2:235097160-235097182 CTGCTTGGCTGCAGGGCAGAGGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948589376 2:239039445-239039467 CTGTGAGCCTGAAGGTCAGTGGG - Intergenic
948610308 2:239162425-239162447 GCGTGGGGTTGCAGGGCAGAAGG - Intronic
948627734 2:239279556-239279578 CTGTCGGGGTGAGGAGCAGAAGG + Intronic
948660820 2:239505540-239505562 CTGAGGGGTGGAGGGGCAGAGGG - Intergenic
948663191 2:239519208-239519230 CTGTCGGGCTCAAGCACAGAAGG + Intergenic
948833363 2:240611800-240611822 CTCTAGGGGTGAAGGGCAGAGGG + Intronic
948870285 2:240794422-240794444 GTGTGTGGGTAAAGGGCAGATGG - Intronic
948993345 2:241565394-241565416 CAGTGGGCCTGAGGGGCAGAAGG - Intronic
1168816868 20:743629-743651 ATGTGAGGCTGAGAGGCAGACGG + Intergenic
1168949155 20:1784692-1784714 TTGTGGGGCTGGAAGGCTGAAGG + Intergenic
1169276570 20:4237096-4237118 ATGTGGATCTGAAGGGGAGAGGG + Intronic
1169812297 20:9620468-9620490 GTCTGGGGCTGATGGGCAGTTGG + Intronic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171177322 20:23062309-23062331 CTGGTGGACTGAAGGGCAGCTGG + Intergenic
1171244506 20:23600738-23600760 CTGAGGAGCTGCAGTGCAGAGGG + Intergenic
1171489227 20:25504793-25504815 ATGAGTGGCTGAAGGGTAGAGGG + Intronic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1172053753 20:32139773-32139795 CTGTGTGGCTACAGTGCAGAAGG - Intronic
1172098675 20:32473155-32473177 CAGTGGGGCTGAAGGGACCATGG - Intronic
1172183388 20:33016979-33017001 CCCTGGGGCTGGAGGGCACAAGG - Intronic
1172527278 20:35607524-35607546 CTGGTGGGCAGAAGGGCAGACGG - Intergenic
1172814083 20:37672552-37672574 GTGGGGGGCTACAGGGCAGAAGG + Intergenic
1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG + Intronic
1173779041 20:45738004-45738026 CTGTGGGGCTGAACAGGAGAGGG - Intergenic
1174572489 20:51511989-51512011 GTGTGTGGCTGAAGAGCTGAAGG - Intronic
1174600981 20:51724624-51724646 CTGTGGGGCTGACATTCAGAAGG - Intronic
1175013836 20:55766969-55766991 CTCTGGGGCAGAGGAGCAGAGGG - Intergenic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175468747 20:59210648-59210670 CCCTGAGGCTGAAGGGAAGAAGG - Intronic
1175948209 20:62568491-62568513 CTTAGGGGCTCAAGGGGAGAGGG + Intronic
1176298735 21:5088511-5088533 CTGGGGTGGTGAAGGGGAGAGGG - Intergenic
1176365285 21:6029107-6029129 GTGTGAGGATGCAGGGCAGATGG + Intergenic
1178351308 21:31874250-31874272 CTGCCGGCCTGAAGGGCAGAGGG - Intronic
1178472774 21:32908743-32908765 CCCTGGGCCTGAAGTGCAGAGGG + Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179597181 21:42450735-42450757 CTGTGGTGCTGAAGAGCTTAAGG + Intergenic
1179758233 21:43509438-43509460 GTGTGAGGATGCAGGGCAGATGG - Intergenic
1179786144 21:43731273-43731295 TTCTCAGGCTGAAGGGCAGAAGG - Intronic
1179858291 21:44173438-44173460 CTGGGGTGGTGAAGGGGAGAGGG + Intergenic
1179894752 21:44355203-44355225 CTGTGGGGAGGAGGGGCAAAGGG - Intronic
1179902276 21:44400399-44400421 CTGTGGGGCTGCGGGGCTGCGGG + Intronic
1180057172 21:45364998-45365020 CTGTGGGCGGGAAGAGCAGATGG + Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1180713980 22:17859056-17859078 CTGGGGGGCTGAGGGGAGGAAGG + Intronic
1180755583 22:18158691-18158713 CTGAGAGGCTGAAAGGCAGAAGG - Intronic
1180844727 22:18974861-18974883 CTGCGGGGCAGCAGGGCAGCGGG + Intergenic
1180928579 22:19573505-19573527 CAGAAGGGCAGAAGGGCAGAAGG + Intergenic
1181022252 22:20109634-20109656 CTGTGGGGCTCAAGGGCAGCAGG + Intronic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181056744 22:20263851-20263873 CTGCGGGGCAGCAGGGCAGCGGG - Intronic
1181339311 22:22165680-22165702 GTGAGGGGCAGAAGGGAAGAGGG + Intergenic
1182146572 22:28000457-28000479 CTGTGGGGTATTAGGGCAGATGG + Intronic
1183538350 22:38415907-38415929 CTGAGGGGCTGAGGGGCTGGGGG + Intergenic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
1184332848 22:43836971-43836993 CTGCGAGGCTGGAGGGCAAAGGG - Intronic
1184352814 22:43955632-43955654 CTCTGGGCCAGCAGGGCAGACGG + Intronic
1184646401 22:45897612-45897634 CTATGGGGCTGTGGGGAAGATGG + Intergenic
1184742689 22:46438228-46438250 CTGTGGGGATGAGAGGCAGCTGG + Intronic
1184786557 22:46674771-46674793 CTGTGTGGCTGCAGGGGAGGGGG + Intronic
1185183772 22:49380190-49380212 CTGTGGGGCTTAGAGGCTGAAGG + Intergenic
1185244343 22:49765292-49765314 CTGGGGGGCTGCAGGGCTGGGGG + Intergenic
1185377080 22:50487581-50487603 CTGTGGGGCTGCCTGGGAGAGGG + Intronic
949474622 3:4431662-4431684 CTGTGCCGGTGAAGGGCAGAGGG - Intronic
949562803 3:5218302-5218324 TTGTGGGGCTGGATGCCAGAAGG + Exonic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950110769 3:10417226-10417248 CAGTGGGGCGGCCGGGCAGAGGG + Intronic
951984221 3:28600410-28600432 CTTTGGGGCTGAATGCCTGATGG + Intergenic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
952660495 3:35840902-35840924 ATGTGGGGCAGAAGGGCAAGAGG - Intergenic
953563861 3:44014614-44014636 GGGTGGGGTTGAGGGGCAGATGG - Intergenic
954292687 3:49658112-49658134 CGGTGGGGCTGAGGGGCTTAGGG - Exonic
954899068 3:54003439-54003461 CTGTGGAGCAGCAGGGCACATGG + Intergenic
956591506 3:70920223-70920245 CTGTGGGCCTCAAAGACAGATGG + Intergenic
957580567 3:82067309-82067331 CTGTGGAGTAGAAGGGCTGAGGG + Intergenic
960055187 3:113272027-113272049 CTGTGAGGCTGAAGATGAGATGG - Intronic
960220869 3:115106798-115106820 CTGGGGGGCAGAGGGGAAGAAGG - Intronic
960373878 3:116874640-116874662 ATGAGGGGCTGGAGGGCAGGAGG + Intronic
960997656 3:123350529-123350551 CTCTGGGGCTGAGGGCCAGGAGG + Intronic
961034034 3:123629846-123629868 CTGTGAGGCTGAGGTGCAGCAGG + Intronic
961260147 3:125595522-125595544 CTGTGGGGCTGTGGGGCTGTGGG - Intergenic
961260150 3:125595530-125595552 CTGTGGGGCTGTGGGGCTGTGGG - Intergenic
961978547 3:131052766-131052788 CTGTAGGGCTTTAGGTCAGAGGG - Intronic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
963222295 3:142825793-142825815 ATACAGGGCTGAAGGGCAGAGGG - Intronic
964668186 3:159196569-159196591 CTGTGAGGCAGAGTGGCAGATGG - Intronic
965742124 3:171886520-171886542 ATGTGTGGCAGAAGGGAAGAAGG - Intronic
966669344 3:182509337-182509359 TTGTGGGGCTGGAGAGCAAAGGG + Intergenic
966775854 3:183542058-183542080 CTGAGGGCCTGCAGGGCAGCCGG - Intronic
966891683 3:184411823-184411845 CTGTGGGGGTGAAGGACGGGGGG - Intronic
966937825 3:184725414-184725436 CTGTGGAGCCAAAGGCCAGATGG + Intergenic
968204789 3:196789779-196789801 CTGTGGGGCTGACGGGGGGGTGG + Intronic
968268674 3:197382614-197382636 CTGTTGGGCAGCAGAGCAGAGGG + Intergenic
968284977 3:197503200-197503222 CTGTGGGGCTGAGGGCGTGAGGG - Intergenic
968347179 3:198019076-198019098 CTTTGTAGCTGCAGGGCAGAGGG + Intronic
968699542 4:2048026-2048048 CTGTGGGGATGAGGTGGAGAGGG + Intergenic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
969432843 4:7166049-7166071 CTCTGGGGCTGAGGAGCAGGAGG + Intergenic
969442740 4:7226944-7226966 CCATGTGGCTGAAGGGCAGTGGG + Intronic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
971454120 4:26828002-26828024 CTATGGGGTTAAAGGGTAGATGG + Intergenic
971455696 4:26841612-26841634 CTGTCAGGCTCAAGGGCATATGG + Intergenic
971736582 4:30461261-30461283 ATGTGGGGCAGAAGGGGAAAAGG - Intergenic
971884253 4:32423388-32423410 CTGAGGCCCTGAAGGGCAGGAGG + Intergenic
972640021 4:40916894-40916916 CTGTGGTGGGGAAGGTCAGAGGG + Intronic
975793880 4:77984805-77984827 CAGAGGGGCAGAGGGGCAGAGGG + Intergenic
975793883 4:77984813-77984835 CAGAGGGGCAGAGGGGCAGAGGG + Intergenic
978271211 4:106893031-106893053 CCATGGGGCTGAGGAGCAGATGG + Intergenic
978479636 4:109174568-109174590 CTGTGGCACTGCAGGGCATATGG + Intronic
981010278 4:139918321-139918343 GTGTGGTGGTGAAGGGGAGAAGG - Intronic
981300849 4:143184839-143184861 CGGAGGGGCGGAGGGGCAGAGGG + Intergenic
982018006 4:151174881-151174903 CAGTGGAGCTGAAGGGTAGGTGG + Exonic
982073755 4:151718550-151718572 CTGAGAGGCTGGAGGCCAGAGGG + Intronic
982201271 4:152963308-152963330 CTATAGGGCTGAAGGGAAGTGGG + Intronic
982208868 4:153019106-153019128 CTGGGGGACTAAAAGGCAGAGGG + Intergenic
982569634 4:157032105-157032127 CTGTGTGGCATAAGGGCATATGG + Intergenic
982689551 4:158532480-158532502 CTGTTGGTCAGAAGGGGAGAAGG - Intronic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
984107727 4:175571090-175571112 CTCTGGGGATGAAAGGCACAAGG + Intergenic
984148704 4:176098236-176098258 CAGTTGGGCTGAAGTGCATATGG - Intronic
984615918 4:181897112-181897134 CTGGCAGGCTGAAGGGAAGAAGG - Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985543975 5:500112-500134 CTGTGGGTTGAAAGGGCAGAGGG + Intronic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
987009911 5:13751856-13751878 GGGTGGGGCAGAAGGGGAGAGGG + Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
988981611 5:36575192-36575214 CTATGGGACTGAAGGGCAAGGGG + Intergenic
989100890 5:37822073-37822095 CTGTGGGCCTGAGAGGGAGATGG + Intronic
990791697 5:59487966-59487988 CTGTGTGTCTGATGTGCAGAGGG - Intronic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991125705 5:63067493-63067515 CTGGGGGACTGAAAGGGAGAGGG - Intergenic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
991683649 5:69162366-69162388 CAGTGGGGTTGGAGGGCTGAAGG + Intergenic
992230617 5:74659920-74659942 CCTTGAGGATGAAGGGCAGAAGG + Intronic
992507208 5:77398691-77398713 CTGTGGCCCGGAAGGGCAGCAGG - Intronic
992869661 5:80993677-80993699 CTGTAGGCCTGAAGGCAAGAGGG + Intronic
992988178 5:82255105-82255127 CTGTGGGGTTGAGAAGCAGAGGG - Exonic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
997196026 5:131980638-131980660 CTGTGGGGCTGGGAGGCTGAGGG - Intronic
997266444 5:132497690-132497712 CTGTGGGGGAGCAGGTCAGAAGG - Intergenic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998040664 5:138949176-138949198 CTGAGGAGCTGAAGGGCCGCAGG - Intronic
998700840 5:144697881-144697903 CTGTGTGGCTTAGGGGAAGATGG + Intergenic
999395234 5:151223087-151223109 CTGTGAGGCAGAGGGGAAGAAGG - Intronic
999450883 5:151677298-151677320 CTTTGTGGCTGCAGGGGAGATGG - Intronic
1000233503 5:159336520-159336542 CTGTGGGGCTGCAGGGGTCATGG + Intergenic
1000355936 5:160395894-160395916 CTTTGGGGCTGAGTGGAAGAAGG - Intronic
1001001449 5:168011221-168011243 CTGTGGGAATGATGTGCAGATGG + Intronic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001317052 5:170651072-170651094 CTCTGCCTCTGAAGGGCAGAGGG + Intronic
1001647678 5:173294497-173294519 CCTCGGGGCTGCAGGGCAGATGG + Intergenic
1002183364 5:177442676-177442698 CTGTGTGGGTGAAGGGGATAGGG + Intronic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002312944 5:178325632-178325654 CAATGGGACTGATGGGCAGACGG - Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002576535 5:180177223-180177245 CTGAGGGGCTGATGTGCACATGG - Intronic
1002843742 6:927437-927459 CTGTGGAGCTGAGGGGTTGAAGG + Intergenic
1003489658 6:6610383-6610405 CTGTGGGTCATAAAGGCAGAGGG - Intronic
1003685722 6:8300063-8300085 CTGTGGGGGAGTATGGCAGAGGG - Intergenic
1003948249 6:11094291-11094313 CTTGGGGGCAGAAGGGCAGTCGG - Exonic
1004267643 6:14163065-14163087 CTGGGAGGCTGCAGAGCAGAAGG - Intergenic
1004459019 6:15818227-15818249 CTGTGGGGTGGCAGGCCAGAGGG - Intergenic
1004895253 6:20141799-20141821 CGGTGGGCATGAAGGGCAGCGGG + Intronic
1005501026 6:26429384-26429406 CTGTGGTGCTTATGGGCAGAGGG - Intergenic
1005505606 6:26466687-26466709 CTGTGGTGCTTATGGGCAGAGGG - Intronic
1005907559 6:30277748-30277770 GTGGGGGGCTGAAGGGAAGGTGG - Intergenic
1006104973 6:31710965-31710987 CAGTGGAGCTGAAGGACAAATGG + Intronic
1006430442 6:33992709-33992731 GTCTGGGGCTGATGGGCAGCTGG - Intergenic
1006448070 6:34091002-34091024 CTGGGGGGCTGTGGGGCTGAAGG - Intronic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006848135 6:37077621-37077643 CTGTGTGGCTGCAGGTCAGGAGG - Intergenic
1006898719 6:37486566-37486588 TGGTGGGGCTGCAGGGCAGGGGG - Intronic
1006923013 6:37638548-37638570 CACTGGGGCTGATGGGCACATGG + Exonic
1007412656 6:41673917-41673939 CTGTGTTGCTGGGGGGCAGATGG - Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1008878375 6:56354186-56354208 CTGTGGGGCTAAAAGTCAGGTGG + Intronic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1012052634 6:94362622-94362644 CTCTGGGGATGCAGGGCACAGGG + Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012259342 6:97069585-97069607 CTGTGGGGCTTTCGAGCAGAGGG + Intronic
1013367842 6:109448444-109448466 CTGAGGGGAGGAAGGGCAGCAGG + Intronic
1013954993 6:115831490-115831512 CTGCAGGGCTGATGGTCAGATGG - Intergenic
1013954995 6:115831498-115831520 CTGTGGGCCTGCAGGGCTGATGG - Intergenic
1013996500 6:116314998-116315020 CTCTGGGGCTGGAAGACAGATGG - Intronic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1016631093 6:146232659-146232681 TTGGGGGGCTGGAGGGCAGGTGG - Intronic
1017988887 6:159469334-159469356 CAGTGGGGCTGATGCACAGATGG - Intergenic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018988824 6:168658086-168658108 CTGGGGGACTGATGGGGAGATGG + Intronic
1019000337 6:168744240-168744262 GTGGGGGGCTGAAGGGCTGAAGG + Intergenic
1019264071 7:102576-102598 ATGAGGAACTGAAGGGCAGAGGG - Intergenic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019735863 7:2649489-2649511 CTGCTGGGCTGCAGGCCAGAAGG - Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1020800203 7:12723689-12723711 CTGAGTGGCTGATGGGCAGAAGG - Intergenic
1021375752 7:19904911-19904933 CTGTTAGTCTGATGGGCAGAAGG + Intergenic
1021390741 7:20089599-20089621 CTATGGGGCTGAAGCTGAGATGG + Intergenic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1023813072 7:43926996-43927018 CGGGGAAGCTGAAGGGCAGATGG + Intronic
1023965293 7:44960915-44960937 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1023965486 7:44961482-44961504 CTGAGGGGGTTAAGGGCTGAGGG + Intergenic
1023965535 7:44961619-44961641 CTGAGGGGCTGAGGGCCTGAGGG + Intergenic
1023965612 7:44961881-44961903 CTGAGGGGCTGAGAGGCTGAAGG + Intergenic
1024224475 7:47315168-47315190 TTGTGGGAATTAAGGGCAGAAGG - Intronic
1024349495 7:48349334-48349356 TTGAGGGGATGAAGGGCAGAAGG + Intronic
1024944188 7:54792506-54792528 CAGTTGGGCGGCAGGGCAGAGGG + Intergenic
1026796073 7:73366920-73366942 CTGTGGGGAGGAGGGGCAGCAGG - Intergenic
1026869617 7:73842324-73842346 CTCTGGGGCTGCAGGGCTGGGGG + Intronic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1027781414 7:82525020-82525042 CTGTGGGGTTGAATGGGAGCTGG + Intergenic
1028160978 7:87484145-87484167 CTGTGGTGGTGAAGGCCAGGGGG + Intergenic
1028239278 7:88399432-88399454 CTGTGGGTTTGAGGGGCTGAGGG + Intergenic
1029539910 7:101176585-101176607 CTATGGGGAAGAGGGGCAGAAGG - Intronic
1029599179 7:101553779-101553801 CTGGGGGACTGAAGGGGACAGGG + Intronic
1029813139 7:103069140-103069162 CAGTGGGGCGGCAGGGCAGAGGG - Intronic
1030333934 7:108303379-108303401 CAGAGGGGCTGAAGAGGAGACGG - Intronic
1030772372 7:113490082-113490104 TTGTGGGGCAGGGGGGCAGAGGG + Intergenic
1032331325 7:130983216-130983238 CTGAGGGGCTGAAGGGGAGCTGG + Intergenic
1032439402 7:131930610-131930632 ATGTTGGGCTGAGGGGCAGACGG + Intergenic
1033333405 7:140433440-140433462 TTCTGGAGCTGAAGGGCACAGGG - Intergenic
1033920645 7:146387382-146387404 CTCTAGGGCTGAAGGGGAGTAGG - Intronic
1034278746 7:149837308-149837330 CAGAGGGGCAGAAGGGCAAAGGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034536673 7:151729705-151729727 CTGCGGGGCTGGACGGCAGCAGG - Intronic
1034678805 7:152912087-152912109 CTGTGGGGCCCAAGGGCAGGAGG + Intergenic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035063675 7:156089977-156089999 CTGTGGTGTAGAAGGGCTGATGG - Intergenic
1035757232 8:2043407-2043429 CAGGGGGGCAGAAGGGCTGAAGG + Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037889807 8:22617959-22617981 CTGTTGGGGTGAATGGGAGAGGG + Intronic
1039474662 8:37833368-37833390 CAGTGGGTCTGAATAGCAGAGGG - Intronic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039850205 8:41358280-41358302 CTGAGGGGCTGAAGTGGGGAAGG + Intergenic
1039961903 8:42254832-42254854 CTGTGGGGCGGCCGGGCAGAGGG - Intergenic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1045432214 8:102124394-102124416 CTGCGGGGCTGCAGTGGAGAGGG - Intronic
1047024262 8:120810330-120810352 ATGTGGGGGAGAAGGGCATATGG - Intronic
1047493138 8:125390489-125390511 CTTCGTGGCTCAAGGGCAGAGGG - Intergenic
1048514506 8:135093646-135093668 TTCTGGGGCTGCATGGCAGATGG + Intergenic
1048552331 8:135445050-135445072 CCGTGGGGGTGAAGGGGAGGGGG + Intergenic
1049298540 8:141856598-141856620 CTGTGGGCTGGAAGGGCAGGAGG + Intergenic
1049347947 8:142148663-142148685 CTCTGGGGCCGAAGGCCAGATGG + Intergenic
1049594213 8:143475996-143476018 CCCTGGGGCTGCAGGGCAGAGGG + Intronic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1051318577 9:15872738-15872760 CTGTGGTTCAGAAGGGTAGAAGG + Intronic
1051609479 9:18947417-18947439 GGGTGTGGCTGAAAGGCAGACGG - Intronic
1052877077 9:33575368-33575390 ATCTGGGGCTGCAGGGCAGCTGG - Intergenic
1052999679 9:34571087-34571109 GTGAGGGGCTGAGGGTCAGAAGG - Intronic
1053376794 9:37614226-37614248 ATGTGGGACTGAGGGGTAGAGGG + Intronic
1053498928 9:38569026-38569048 ATCTGGGGCTGCAGGGCAGCTGG + Intronic
1053662269 9:40292273-40292295 ATCTGGGGCTGCAGGGCAGCTGG - Intronic
1053912720 9:42922440-42922462 ATCTGGGGCTGCAGGGCAGCTGG - Intergenic
1054522341 9:66084011-66084033 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
1056173639 9:84012885-84012907 GATTGGGGGTGAAGGGCAGATGG + Intergenic
1056586515 9:87930987-87931009 ATCTGGGGCTGTAGGGCAGCTGG + Intergenic
1056610363 9:88121955-88121977 ATCTGGGGCTGTAGGGCAGCTGG - Intergenic
1056628841 9:88276050-88276072 ATGTGGGGCAGAGGGGAAGAGGG - Intergenic
1056757388 9:89390362-89390384 CTGCGGGGCTGCGGGGCAGCTGG + Intronic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1057161974 9:92895333-92895355 ATGTGGGGCTGCCGGGCAGCTGG + Intergenic
1057376475 9:94528594-94528616 CTTTGTAGCTGCAGGGCAGAGGG + Intergenic
1057678375 9:97153518-97153540 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
1058021994 9:100099178-100099200 CTGTGGGATAGAAGGGCGGAGGG + Intergenic
1058576858 9:106413030-106413052 GTGTGGGGCTGAAGCCCAGTCGG - Intergenic
1058972378 9:110095492-110095514 CTGAGTGGCTGAAGGGGAGCTGG - Intronic
1059023694 9:110602442-110602464 CTGTGTGGGTGAGGGGTAGAAGG - Intergenic
1059940040 9:119349770-119349792 CTGTGGAGGGGAAGTGCAGAGGG + Intronic
1060209329 9:121700213-121700235 TGGTGGGGCAGAAGGGGAGAGGG + Intronic
1060217120 9:121745093-121745115 ATGTGGGGGAAAAGGGCAGACGG + Intronic
1060996412 9:127876873-127876895 CTGTGGGGCCGAAGCCCAGAGGG + Intronic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061412717 9:130430018-130430040 CTGGGGCACTGAAGGGCTGAGGG + Intronic
1061420292 9:130469892-130469914 CAGTGGGGCTGAGGGGCTGAAGG + Intronic
1061532898 9:131228774-131228796 CTGGGGGGCTGCAGGGGAGCAGG - Intronic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1061808172 9:133148039-133148061 CGGGGGGGCTGAAGGGCTGAGGG - Intronic
1061904329 9:133688928-133688950 CTGTGGTGCTCAGGGGCACACGG - Intronic
1062035262 9:134380061-134380083 CAGAGGGGCTGCAGGGGAGAGGG - Intronic
1062051324 9:134448562-134448584 CTGTGGGGCAGAATGTCACAGGG + Intergenic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1062468403 9:136691601-136691623 GTGTGGGGCTGAAGAGCCCAGGG + Intergenic
1062582504 9:137234765-137234787 CTGTGGGGCTGAGAGGAAGCTGG - Intronic
1062699544 9:137891738-137891760 CTGTGGGGCTGTAGAGTGGAGGG + Intronic
1186897638 X:14020359-14020381 CTTTGGGGAAGAAGCGCAGAAGG + Exonic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1190574472 X:51819175-51819197 ATGTGGGGCAGAGGGGAAGAAGG - Intronic
1190734698 X:53248569-53248591 CTTTGGGGCAGAAGGGTACAGGG + Intronic
1190970278 X:55341851-55341873 CAGTGGGGCTTTGGGGCAGAGGG - Intergenic
1192048377 X:67700323-67700345 CTCTGGGGCTCAGGTGCAGAGGG + Intronic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1192326012 X:70133167-70133189 CTTGGCGGCTGAAGGGCACAGGG + Intergenic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196370867 X:114978336-114978358 CAGTGTGGCTGAAAGACAGATGG + Intergenic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1198075707 X:133191004-133191026 CTCTGGGGCTGAGCAGCAGATGG + Intergenic
1198447624 X:136733980-136734002 ATCTGGCCCTGAAGGGCAGATGG + Intronic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1199758741 X:150889247-150889269 GAGTGGATCTGAAGGGCAGATGG - Intronic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1200055221 X:153456701-153456723 CTGTGGGGCTGAGGGCCTGCTGG - Intronic
1200101860 X:153692322-153692344 CAGTGGGGGTGATGGGCACAGGG - Intronic
1200137494 X:153882160-153882182 CCGAGGGGTTAAAGGGCAGAGGG + Intronic
1200658920 Y:5938344-5938366 CAGTGGGGCAGCCGGGCAGAGGG - Intergenic
1201947361 Y:19526486-19526508 CTGAGGCCCTGAAGGGCTGAGGG - Intergenic