ID: 1179438073

View in Genome Browser
Species Human (GRCh38)
Location 21:41375593-41375615
Sequence CTGGAGACACACAGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 585}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179438073_1179438082 11 Left 1179438073 21:41375593-41375615 CCCTTCTCCCTGTGTGTCTCCAG 0: 1
1: 0
2: 2
3: 52
4: 585
Right 1179438082 21:41375627-41375649 CCCTCTGCCTGTCTCTGATAAGG 0: 1
1: 3
2: 36
3: 158
4: 527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179438073 Original CRISPR CTGGAGACACACAGGGAGAA GGG (reversed) Intronic
900491445 1:2951261-2951283 CTAGAGACACACAGGGTGCTGGG + Intergenic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
900539881 1:3197328-3197350 CTGGGGGCACACAGGAAGGAGGG - Intronic
900822202 1:4898426-4898448 GTTGAGACACACAGGGGGCAAGG - Intergenic
901156048 1:7139607-7139629 CTGCAGACAGACAGGAGGAAAGG - Intronic
901222248 1:7589887-7589909 CTGAAGCCACACAGCCAGAAGGG - Intronic
901452853 1:9346422-9346444 CTGGGGACAGACAGACAGAAAGG - Intronic
902452420 1:16505511-16505533 CTGAAGACACCCAGGCAGGAAGG - Intergenic
902477845 1:16697555-16697577 CAGGAGGCACCCAGGAAGAAGGG + Intergenic
902598666 1:17526187-17526209 TTGCAGCCACACAGGGAGGAAGG - Intergenic
902941858 1:19806082-19806104 CTGGGGAAAAACAGGGTGAAAGG - Intergenic
903209946 1:21812327-21812349 CTGGTGGGACACAAGGAGAAGGG - Exonic
903678293 1:25080335-25080357 CTGCGGACTCACAGGGAGAGAGG + Intergenic
903806160 1:26007038-26007060 CAGGAAGCAGACAGGGAGAAGGG - Intergenic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
904041067 1:27585605-27585627 CTGAAGACACACAAGGAAACGGG + Intronic
904503926 1:30935386-30935408 CTGGAGAAATACAGGGGAAAGGG - Intronic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
905107940 1:35575078-35575100 CTGGCGACACACAGGAGGCACGG - Intronic
905304118 1:37005851-37005873 CTGGGGACACAGAGGTAGATGGG + Intronic
905335586 1:37242452-37242474 CTGGCGACAGAGAGAGAGAATGG - Intergenic
905354679 1:37373120-37373142 CTGGGGAGGCAAAGGGAGAAAGG + Intergenic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
906492215 1:46277636-46277658 CAGGAGACAGACTGGGAAAATGG + Exonic
906645868 1:47474511-47474533 TGGGAAACACACAGGGAGATAGG + Intergenic
907067082 1:51494763-51494785 ACGCAGACATACAGGGAGAATGG - Intronic
907649071 1:56276148-56276170 CTGGAGACGAACAGAGAGGAGGG - Intergenic
908683414 1:66687818-66687840 GTGGAGACAGAGAGGGAGCAGGG + Intronic
909992670 1:82241821-82241843 TAGGAGAAACACAGGCAGAATGG + Intergenic
911038440 1:93573502-93573524 ATGGAGACAAAGAGGGAAAATGG - Intronic
911148220 1:94571770-94571792 GGGGAGAGACACAGAGAGAAGGG + Intergenic
911154278 1:94623609-94623631 CATGAGACACACAGGGAGGCTGG - Intergenic
911273301 1:95829812-95829834 CTGCTGACACACAGGAGGAAAGG + Intergenic
911670592 1:100603526-100603548 CTGGTGATACCCAGGGAAAAGGG - Intergenic
912521325 1:110246923-110246945 ATGGAGACTCAGAGGGAGAGAGG - Intronic
914095714 1:144543091-144543113 CTGAAGACACCCAGGCAGGAAGG - Intergenic
914767333 1:150650261-150650283 CTGGCAACACACAGGGAGTTAGG + Intronic
915211480 1:154312898-154312920 CAGGAGTCCAACAGGGAGAAAGG - Intergenic
915212613 1:154321875-154321897 CAGGAGACCAACAGGGAGAAAGG - Intronic
915300451 1:154948410-154948432 ATGGGGAGACACAGGGAGAGAGG + Intronic
915314953 1:155023284-155023306 CTGCAGACATCCTGGGAGAAGGG + Intronic
915346108 1:155197791-155197813 GAGGAAACAGACAGGGAGAATGG - Intronic
915764971 1:158353756-158353778 CTGGAGCCAGACAGTGAGAGAGG + Exonic
916446941 1:164881271-164881293 CTGCAGAGACACAGAGAGAAAGG + Intronic
917734641 1:177909296-177909318 CTGGTGACACCCAGGGAGAGAGG + Intergenic
917915386 1:179695869-179695891 CTGGACAGTGACAGGGAGAATGG + Intergenic
918956851 1:191218733-191218755 CAGGAGAGACACAGAGAGAAAGG + Intergenic
919516741 1:198534289-198534311 GAGCAGACACACAGGGAGGAAGG + Intronic
919752483 1:201047000-201047022 ATGGAGACATAGAGGGAAAAAGG - Intronic
919795234 1:201317692-201317714 CTGGAGACCCGGAGGCAGAATGG + Exonic
919860627 1:201737533-201737555 GGTGAGACACACAGGGAGGAGGG + Intronic
920618505 1:207520510-207520532 GAGGAGACAGACAGAGAGAAGGG - Intronic
921139174 1:212289262-212289284 CAGGAGATACACAGGGATTAAGG - Intronic
921616771 1:217277600-217277622 CTGTTGACACACAGGGATTATGG - Intergenic
921999228 1:221457776-221457798 CTCGGAATACACAGGGAGAAGGG - Intergenic
922692009 1:227700467-227700489 CTGGTGATACACAGGCAAAAAGG + Intergenic
923110505 1:230886109-230886131 TTGGAGAGAGACAGTGAGAATGG + Intergenic
923275558 1:232392607-232392629 CTGGGGACACTCAAGGGGAAGGG + Intergenic
924603986 1:245516578-245516600 GTGGAGACACCCAGGGTCAAAGG - Intronic
924670626 1:246120757-246120779 CTGGAAACACACAGGAGGGATGG - Intronic
1063102057 10:2958886-2958908 CTGGTGACAGACATGCAGAATGG + Intergenic
1063702872 10:8402466-8402488 CTGAAGGGACACAGGGCGAAAGG + Intergenic
1064229361 10:13516356-13516378 CTGGTGACACACAGGGGCACAGG + Intronic
1064364689 10:14697055-14697077 ATGGGGAGGCACAGGGAGAAAGG + Intronic
1065047134 10:21754599-21754621 CTGGAGAGGGACAGGGAGAGGGG - Intergenic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1066810589 10:39328530-39328552 CTTGAGACATACAGCGAAAAAGG - Intergenic
1067085486 10:43235840-43235862 CTGCAGCCACACAGGCAGGACGG + Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1068173868 10:53430917-53430939 CTGGAAACAAACAGGCAAAATGG - Intergenic
1068548167 10:58376052-58376074 CTGGAGACACACATTTAAAAAGG - Intergenic
1069307465 10:66988844-66988866 GTGGAGAGAAACAGGGAGGAGGG - Intronic
1070324919 10:75382449-75382471 CTGGGGACACACAGCCAGAGAGG - Intergenic
1070473694 10:76811453-76811475 AAGGAGACAGAAAGGGAGAAGGG - Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071519296 10:86319150-86319172 GGGGAGGCACCCAGGGAGAAAGG + Intronic
1072070406 10:91909590-91909612 CTGGAGAGACAGAGAGAGAGAGG - Intergenic
1072098613 10:92207394-92207416 CTGGAGACAGAAAGACAGAATGG + Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1073148025 10:101293023-101293045 CTGGAGAGACACAGGGTGGGTGG - Intergenic
1073291187 10:102414072-102414094 CTGGAGTCACACCGGGCCAAAGG - Exonic
1073909189 10:108321108-108321130 GTTAAGACACACAGGGAGGATGG - Intergenic
1073993522 10:109290768-109290790 TTGGAGACACACAGTTACAAAGG - Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074703703 10:116113562-116113584 CCAGAGACACCCAGGGAGAGTGG - Intronic
1074800379 10:116994498-116994520 CTGTAGAGACAGAGAGAGAAGGG + Intronic
1075103035 10:119519317-119519339 CTGGGGACAGACAGGGAGACAGG - Intronic
1075103108 10:119519636-119519658 TGGGAGACAGACAGGGAGACAGG - Intronic
1075670834 10:124263112-124263134 CTGGAGAGACACAGGCAGGCAGG - Intergenic
1075937132 10:126351879-126351901 TTGGACACACACAGGAAGAGTGG + Intronic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1078670092 11:13356933-13356955 CTGCAGACACACAAGGGGACTGG - Intronic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1078750963 11:14163449-14163471 CTGGAGAAATAAAAGGAGAATGG - Intronic
1079390895 11:20021453-20021475 ATGGAGACACACAGGCACATGGG - Intronic
1080829421 11:35877412-35877434 GTTGAGAGACACATGGAGAAGGG + Intergenic
1080951263 11:37035851-37035873 CAGGAAATCCACAGGGAGAATGG + Intergenic
1083213615 11:61204676-61204698 CTGGAGCCACGCAGGAAGAGCGG + Intronic
1083276521 11:61600009-61600031 CTGGAGTCGCACAGGAAGACGGG - Intergenic
1083609175 11:63997027-63997049 CTGCAGCCACGGAGGGAGAAAGG - Intronic
1084006883 11:66327873-66327895 CTGGACACACACATGGGGACAGG - Intergenic
1084383468 11:68828204-68828226 CTTGGGAGACACAGGGAGATGGG - Intronic
1085539622 11:77254358-77254380 CAGGAGACCCACATAGAGAATGG - Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1085884552 11:80506417-80506439 CTGGCGACACCCAGGAAGACAGG + Intergenic
1088096634 11:106108204-106108226 ATGCAGAAACACAGGGAGAGGGG - Intergenic
1089126705 11:116181290-116181312 ATGGAGTCACACAGGCAGGAAGG + Intergenic
1089153193 11:116380496-116380518 TTGCAGAGACACATGGAGAAAGG - Intergenic
1089309613 11:117549048-117549070 TTGGAGCCACACAGGGACACAGG - Intronic
1089866124 11:121633692-121633714 CTCGAGACACACAGAGACAGTGG - Exonic
1090168517 11:124577512-124577534 CAGCAGGCACACAGAGAGAATGG + Intergenic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1090419230 11:126562584-126562606 TAGGAGACACAAAGGGAGAAGGG + Intronic
1090964455 11:131585816-131585838 CTGGAGCCACAGTGGGAAAAAGG - Intronic
1090985599 11:131762997-131763019 CTGCTGACACCCAGGGAGACAGG + Intronic
1091393798 12:141555-141577 CTGGAGAGTGACAGGCAGAAAGG - Intronic
1092109164 12:5946597-5946619 CTGGAAGTAGACAGGGAGAAAGG - Intergenic
1092512536 12:9171874-9171896 CTTGAAAGAGACAGGGAGAATGG + Intronic
1092884553 12:12913763-12913785 CGGGAGAGACACATGAAGAAGGG - Exonic
1092918562 12:13209988-13210010 TTGGAGACGGTCAGGGAGAATGG + Intronic
1092981893 12:13803878-13803900 CTGCAGGCTCACAGGCAGAAAGG - Intronic
1093267447 12:17020312-17020334 AGGGAGAGACACAGGGAGGAAGG - Intergenic
1094426383 12:30321072-30321094 TTGGAGTCAGATAGGGAGAATGG - Intergenic
1094477490 12:30852446-30852468 ATGGAGGCATGCAGGGAGAAAGG - Intergenic
1095601343 12:44016422-44016444 CAGGTGGGACACAGGGAGAAAGG - Intronic
1098304629 12:69090226-69090248 CTGGAGAGAGACAGAGAGAGAGG + Intergenic
1101549675 12:105750340-105750362 ATTGGGACACACAGGGAGAGAGG + Intergenic
1101881628 12:108629774-108629796 CTGAGGCCACACAGGTAGAAGGG + Intronic
1102425281 12:112839044-112839066 CCTGAGACTCACAAGGAGAAAGG - Intronic
1102462934 12:113111398-113111420 CTTAAGTCACACAGGTAGAAAGG - Intronic
1102472172 12:113165549-113165571 CTGGGGTCACACAGTGACAACGG - Intronic
1102491335 12:113291207-113291229 CTGGGGACATGCAGGGAGATGGG - Intronic
1102687961 12:114738964-114738986 CTGGGGACAAACAGGAAGATGGG + Intergenic
1102874227 12:116437214-116437236 CTGGACACACATTAGGAGAAAGG + Intergenic
1102887904 12:116535382-116535404 CTGGGGTCACACAGCTAGAAAGG - Intergenic
1102890052 12:116551769-116551791 ACAGAGGCACACAGGGAGAAAGG - Intergenic
1102953591 12:117045761-117045783 CTTTAGACACACAGGGGCAAAGG + Intronic
1103124553 12:118410153-118410175 CTGGGGACAAACAGTGAGAAAGG - Intronic
1103160314 12:118723689-118723711 CTGGAGAAACACTGGGAGCCAGG + Intergenic
1103241162 12:119414342-119414364 AGGGAGACACACAGTGAGGATGG - Intronic
1103845935 12:123902149-123902171 GTGCAGACACACAGGGAAGAGGG - Intronic
1103920036 12:124394582-124394604 ACAGAGACACGCAGGGAGAAAGG + Intronic
1104177613 12:126348201-126348223 CTGGAGACTCGAAGGGAGGAAGG - Intergenic
1104271073 12:127282747-127282769 CTGGAGACACACAGCCAGGGAGG + Intergenic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1105631000 13:22168336-22168358 CTTTAGACACACAGGGTAAAAGG + Intergenic
1106042285 13:26104360-26104382 CTGGAGACACCCAGGCAAACAGG + Intergenic
1106625844 13:31420319-31420341 CTGGATACACACAGGAAGGAAGG + Intergenic
1106777800 13:33025459-33025481 CTGGGCACACAAAGTGAGAAGGG + Intronic
1106996015 13:35480856-35480878 CAGGAATCACACAGGAAGAAAGG - Intronic
1107446297 13:40472750-40472772 CTGGAGACACACGGGCTGAGTGG + Intergenic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108635185 13:52326916-52326938 GTGGAGACACACAGACTGAAAGG + Intergenic
1108652623 13:52496313-52496335 GTGGAGACACACAGACTGAAAGG - Intergenic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1111141105 13:84119188-84119210 TTGGGGACACTCAGGGGGAAGGG + Intergenic
1111235587 13:85404031-85404053 CTGGAGATAGACAGTGAGGATGG - Intergenic
1112163210 13:96890313-96890335 ATGCAGACACACAAGGAGTAAGG + Intergenic
1112312793 13:98334379-98334401 TTTGATACACACAGGCAGAAGGG + Intronic
1112552038 13:100430483-100430505 CTGGAGGAACACAGAGAGGATGG - Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112594670 13:100796912-100796934 CTGCAGAACCACAGGGAGATGGG + Intergenic
1112742533 13:102491502-102491524 CTGTGGGCACTCAGGGAGAAAGG + Intergenic
1112924546 13:104657552-104657574 AGGGAGAGACAGAGGGAGAAAGG - Intergenic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1113334835 13:109367781-109367803 CTAAATGCACACAGGGAGAATGG + Intergenic
1113580733 13:111426791-111426813 CTGGAGCCAGGCAGGGAGAGGGG - Intergenic
1113811894 13:113147714-113147736 CTGGACACCCAGTGGGAGAAGGG - Intronic
1114272494 14:21110395-21110417 ATGAAGACACGCAGGGATAATGG + Intergenic
1114367707 14:22047767-22047789 CTAGGCACACACATGGAGAATGG + Intergenic
1114451719 14:22830794-22830816 CTGGAGTCTCATAAGGAGAATGG - Intronic
1115385365 14:32790254-32790276 CTTGAAAGAGACAGGGAGAATGG + Intronic
1115392150 14:32866053-32866075 CTGGAAACACCCAGAGAGCAGGG - Intergenic
1115916003 14:38315343-38315365 CTGGAGACATCCACGGTGAAAGG - Intergenic
1116479717 14:45383540-45383562 CTGGGGACAGCCAGGGAGATTGG + Intergenic
1117206155 14:53445810-53445832 ATAGAGAAACACAGGAAGAAGGG + Intergenic
1117243940 14:53864658-53864680 TTGAAGACTCAAAGGGAGAAGGG - Intergenic
1117502970 14:56372912-56372934 CCTGAAACAGACAGGGAGAATGG - Intergenic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1118685998 14:68291861-68291883 CTGTGAACAGACAGGGAGAAGGG - Intronic
1118707373 14:68492772-68492794 CTGGAGAGACAATGGTAGAAGGG - Intronic
1118902534 14:69998843-69998865 CTGGAAAAAAACAGGGACAAAGG - Intronic
1119134916 14:72208581-72208603 CTGGAGATACAAAGGGAAATAGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119846740 14:77836126-77836148 GTGGAGACAGAGAGGGAGAGAGG - Intronic
1120037070 14:79709800-79709822 CTGAAGACAGACAAGGAGAGAGG + Intronic
1120640211 14:87001245-87001267 CTGCAGGCACTCAGGGAGAATGG - Intergenic
1121278711 14:92685312-92685334 CTGGACACACACTGGCAGCAGGG - Intronic
1121328864 14:93037086-93037108 CAGGAGCCACCCAGGGAGCAGGG - Intronic
1121748869 14:96328710-96328732 CTGAAGACACACAGGGGAATGGG + Exonic
1122039002 14:98968965-98968987 ACTGAGGCACACAGGGAGAAAGG + Intergenic
1122211969 14:100179137-100179159 GTGGAGTCACACAGGGTGGAGGG + Intergenic
1122254883 14:100469246-100469268 CAGGAGACGCAGAGGGAAAATGG + Intronic
1122283714 14:100638830-100638852 CTGGAGACAAACAGTGACCAAGG - Intergenic
1122778795 14:104134979-104135001 CTGGAGAGGGACAGAGAGAAAGG + Intergenic
1123400883 15:19984780-19984802 ATGGAGACAGAGAGAGAGAAAGG - Intergenic
1124215994 15:27807408-27807430 CTGGGGACACACTGGGCAAAGGG - Intronic
1124346983 15:28929577-28929599 CAGGCGACACACAAGAAGAAGGG + Intronic
1124382454 15:29177904-29177926 CGGGAGGGATACAGGGAGAAGGG + Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124787016 15:32690946-32690968 CTGAAGGCAGAAAGGGAGAAGGG - Intronic
1125762399 15:42105498-42105520 CTGAGGACACCCAGGGAGGATGG + Intergenic
1125770087 15:42159440-42159462 CTGATGACACACAGGGAGAGTGG - Exonic
1126704850 15:51397447-51397469 CTGGAGAGAGAGAGAGAGAAAGG - Intronic
1128145859 15:65332188-65332210 CTGGAGATACACAGGGTGAGAGG + Intronic
1128860580 15:71067937-71067959 CTGGAGACACCCAGACACAAAGG - Intergenic
1129655695 15:77524228-77524250 AGGGAGACAGACAGAGAGAAAGG + Intergenic
1129675179 15:77629429-77629451 CTGCAGAGACACAGAGAGCAGGG - Intronic
1129871692 15:78945372-78945394 GTGGGGACACGCAGGGAGATGGG - Intronic
1129871974 15:78946256-78946278 GTGGAGACACACAGGGACATGGG - Intronic
1130052529 15:80495744-80495766 CTGGAGCTCCACAGGGAGAGGGG - Intronic
1130718832 15:86366033-86366055 CTGGGGACACAAAGGGCTAAAGG - Intronic
1130891443 15:88137118-88137140 CAGGTAACTCACAGGGAGAAAGG + Intronic
1130893851 15:88155381-88155403 CTGGAGGCTCTAAGGGAGAATGG - Intronic
1131168940 15:90162867-90162889 CTGGGGAGATAAAGGGAGAAAGG - Intronic
1132554199 16:565451-565473 CTGGGGCCACACAGGGACACTGG + Exonic
1132819209 16:1854406-1854428 TTGAAGAGACACAGGGAGACAGG + Intronic
1133393802 16:5430121-5430143 CTGGGGGGATACAGGGAGAAGGG + Intergenic
1134303627 16:13012984-13013006 GTGGAGGGAGACAGGGAGAAGGG + Intronic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1135856852 16:26019597-26019619 TTGGAAACACACAGGGAGGGCGG + Intronic
1136108462 16:28048971-28048993 CTGGAGAAAAAAAGGGAGAAGGG + Intronic
1137356744 16:47773800-47773822 CTGGACAGTGACAGGGAGAATGG - Intergenic
1138101638 16:54256612-54256634 CTGCAGCCCCCCAGGGAGAAAGG - Intronic
1138542135 16:57694922-57694944 CTGGAGGCCCCCAGGCAGAAGGG - Intronic
1138997765 16:62475221-62475243 CAGGAGACAGAGAGAGAGAAAGG - Intergenic
1139890774 16:70252027-70252049 CTGGAGGCCCGGAGGGAGAACGG + Intergenic
1139974915 16:70801797-70801819 CTGGTTACAGACAGAGAGAAAGG + Intergenic
1140780601 16:78293151-78293173 CTGGAGCCACACAGCTAGAATGG - Intronic
1141195138 16:81854726-81854748 CTAAAGACACACAGCTAGAAAGG - Intronic
1141805906 16:86341343-86341365 CTGTGGACACACAGGGAGCGCGG + Intergenic
1142221706 16:88858082-88858104 CTGAACACACACAGGGTAAATGG + Intronic
1142483164 17:230773-230795 CCAGAGACACACGGAGAGAAAGG - Intronic
1143081303 17:4383360-4383382 ATGCAGATACACAGGGATAAAGG + Intergenic
1143592548 17:7894346-7894368 ATGGAGAGAGAGAGGGAGAAGGG - Intronic
1143993517 17:10987425-10987447 TCAGAGACACACAGAGAGAAAGG + Intergenic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1144809961 17:17992742-17992764 CTGGGGAGAAAAAGGGAGAAAGG - Intronic
1146545316 17:33733344-33733366 CAACACACACACAGGGAGAAAGG - Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147522104 17:41183393-41183415 ATGGAGCCACACAAGGACAAGGG - Intergenic
1147648555 17:42049097-42049119 CTGGAGGAACCCAGAGAGAAGGG - Intronic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1150368601 17:64614693-64614715 CTTGAGATACTTAGGGAGAAAGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150652296 17:67018009-67018031 CGGGAGAGACACACAGAGAATGG - Intronic
1151210230 17:72538936-72538958 CTGGAGAGAAACTGGGAGGAGGG + Intergenic
1151360326 17:73584785-73584807 CTGCAGGGACACAGGCAGAAGGG - Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152260454 17:79263953-79263975 CTTGAGACACACAAGGAAGAAGG + Intronic
1152804149 17:82347180-82347202 CTGGAGACAGAGAGACAGAAGGG + Intergenic
1152809708 17:82375666-82375688 CTGGAGACCCTCAGGGAGGCGGG - Intergenic
1152890654 17:82879941-82879963 CTGGAGACACCCAAGGAGACAGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1154251167 18:12746416-12746438 CTGGACAGACACAGGGTGAGGGG + Intergenic
1154399579 18:14023758-14023780 CAGGAGAGTCACAGGGTGAAAGG + Intergenic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1157198641 18:45640360-45640382 CTGGAGAGACACAGGGGTAGGGG + Intronic
1157483648 18:48072397-48072419 ATGCAGCCACCCAGGGAGAAGGG - Intronic
1157880853 18:51319839-51319861 CTGGAGACAGAGAGAGTGAAGGG + Intergenic
1158580228 18:58674324-58674346 GTGGAGTCACACAGAGAGAAGGG + Intronic
1158627637 18:59085242-59085264 CAGGAGCCACACTAGGAGAATGG - Intergenic
1159122512 18:64187248-64187270 CTGTGGAAACTCAGGGAGAATGG + Intergenic
1159363416 18:67434540-67434562 ATTGAGACACCCATGGAGAATGG + Intergenic
1159950683 18:74480523-74480545 ACAGAGACACACAGGGACAAAGG + Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160246304 18:77162861-77162883 CTGGAGACACTGTGGGTGAAAGG + Intergenic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1162479928 19:10922098-10922120 CTGGAGACAGGCAGGGGGACAGG - Exonic
1162957332 19:14106797-14106819 CTGGTGAAACACAAGGAGACCGG - Exonic
1163006651 19:14401273-14401295 CTGGAGACCCACAGGCACAAGGG - Intronic
1163170095 19:15525313-15525335 CTGGGGACACACAGGGTCAGGGG - Intronic
1163578426 19:18123875-18123897 CTGGAGTGACACACGCAGAATGG - Intronic
1163635440 19:18435145-18435167 CCAGACACCCACAGGGAGAAAGG + Intronic
1164508063 19:28875526-28875548 GAGGAGGCACACGGGGAGAATGG - Intergenic
1164544233 19:29145851-29145873 CTGGAAACACACAGAGCTAAGGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1166171985 19:41034580-41034602 CTTGAAACTGACAGGGAGAATGG + Intergenic
1166720447 19:44993094-44993116 CTGGAAACACAGAGGGACAGAGG - Exonic
1166870797 19:45869316-45869338 CTGGGGTCACACAGCAAGAATGG - Intronic
1167027099 19:46928539-46928561 CTGGAGCCAAACAGCGAGGAGGG - Intronic
1167326934 19:48832459-48832481 CTGGGGACACACAGGAGGGATGG + Intronic
1167383167 19:49150021-49150043 CTGGAGAGGAACAGGGAGGAGGG + Intronic
1167507881 19:49880727-49880749 CTGGGGTCACACAGGGTGCAGGG + Intronic
1167699505 19:51034140-51034162 CTGGAGACAGACAGGGGCATGGG + Intronic
1168079855 19:54001765-54001787 GTGGAGAGAGACAGGGAGACTGG + Intronic
1168269946 19:55244364-55244386 CTGGAGAAACACATGGACATGGG + Intronic
1202711863 1_KI270714v1_random:23381-23403 CAGGAGGCACCCAGGAAGAAGGG + Intergenic
925843767 2:8017570-8017592 CTGGTGACGGACAGGGAGACAGG + Intergenic
925930837 2:8706490-8706512 CTGGAGGCACACAGGCAGGAAGG - Intergenic
925944589 2:8849360-8849382 CTGGAGCCAGCCAGGGAGGAGGG + Intergenic
926143290 2:10381343-10381365 CTGGAGCCACACAGCGGGAAGGG - Intronic
926337512 2:11875287-11875309 CATGAGACCCACAGGGAGAGTGG - Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
927152610 2:20204479-20204501 CTGGACACACACAATGGGAAGGG - Intronic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927862891 2:26571126-26571148 CTGGAGACCCAGAGGTAGAGAGG + Intronic
927867956 2:26604423-26604445 CAGGAAACACACAGGTAGAGAGG + Intronic
928180153 2:29063003-29063025 CAGGAGACACACAGTGTGAGCGG - Exonic
928482451 2:31696344-31696366 CCTGAGAGACACAGGGAGAGAGG + Intergenic
929813645 2:45213342-45213364 GTGGAAACAGACAGGGAGAGAGG + Intergenic
929917878 2:46151326-46151348 CTGGACAGAGAAAGGGAGAAGGG - Intronic
930002232 2:46869222-46869244 CAGGAGGCACACAGGGAGCTTGG - Intergenic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
930977623 2:57482823-57482845 CTGGGGACAGACAGAAAGAAGGG + Intergenic
931845287 2:66197572-66197594 CAGGAGATACCCAGGGTGAAGGG + Intergenic
932449202 2:71798880-71798902 CTGGAGACAGACAGCGGGAAGGG + Intergenic
934035859 2:88088098-88088120 GAGGAGACAGACAGGGAGGATGG - Intronic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
934796930 2:97109274-97109296 CTGGTGACTCAAAGAGAGAAAGG - Intergenic
934836483 2:97594157-97594179 CTGGTGACTCAAAGAGAGAAAGG + Intergenic
934983156 2:98864415-98864437 CTGGGGAAACACAGGTAGAATGG + Intronic
935744545 2:106179101-106179123 ATGGAGCCACAGAGGGAGACTGG - Intronic
935752128 2:106245015-106245037 CTGGAGACTCACAATCAGAAAGG - Intergenic
935762722 2:106336299-106336321 CAGGAAACACTCAGGGAGACAGG - Intergenic
935877902 2:107531839-107531861 CAGTAGCCACACAGGGAGAATGG - Intergenic
935912540 2:107912562-107912584 CTGGAGACTCACAATCAGAAAGG - Intergenic
936259588 2:110947612-110947634 CTGGAGGCAGAGGGGGAGAAGGG - Intronic
936381964 2:111994228-111994250 CTGGAGACAGAGAGGAAGAGAGG - Intronic
936545321 2:113387303-113387325 CTGGTGACTCAAAGAGAGAAAGG - Intergenic
937317383 2:120940607-120940629 CTGGGGTCACAGAGAGAGAATGG - Intronic
937342191 2:121098428-121098450 TTGAAGTCACACAGGGAGAAGGG - Intergenic
937510780 2:122592539-122592561 CTACAGACACACAGGCAGAGTGG + Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937880184 2:126858819-126858841 CTGGAGGAAAGCAGGGAGAATGG - Intergenic
940482583 2:154253973-154253995 CTTGAGATACACAGTGATAAGGG + Intronic
940669290 2:156648241-156648263 CTGAAGACCTACAGGGGGAAGGG + Intergenic
941002184 2:160213738-160213760 CTGGAGGCTCTGAGGGAGAAGGG + Intronic
941324689 2:164099093-164099115 CTGCTGGCACACAGAGAGAATGG + Intergenic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
945251494 2:207769230-207769252 CGGGAGAAGAACAGGGAGAAAGG + Intronic
945686267 2:212974273-212974295 CTGGTGACAAGAAGGGAGAATGG + Intergenic
946324026 2:218973914-218973936 CTAAAGTCACACAGTGAGAAAGG - Intergenic
947310638 2:228798063-228798085 CTTGAGTCACACAGATAGAAAGG - Intergenic
947494134 2:230620783-230620805 CTGGAAAGTGACAGGGAGAAGGG + Intergenic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
948661309 2:239508188-239508210 ATGGAGACTCGCAGAGAGAAGGG - Intergenic
948853662 2:240720195-240720217 CAGGAGAGCCACTGGGAGAAGGG - Intronic
1168840638 20:907865-907887 CTGGAGTCGTACAGGCAGAAAGG - Intronic
1169836025 20:9880087-9880109 CTGGAACCACACAGGGAGACAGG - Intergenic
1170179505 20:13513446-13513468 GGGGAGACAGAGAGGGAGAATGG + Intronic
1170543520 20:17412563-17412585 CTTGAAACTGACAGGGAGAATGG + Intronic
1170866078 20:20159536-20159558 GTGGAGACAGGCAGGGAGATTGG - Intronic
1171194537 20:23186968-23186990 CAGCAGACACCCAGTGAGAAAGG - Intergenic
1171194577 20:23187190-23187212 CTGGAGAGAGACAGGCACAAGGG - Intergenic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172632766 20:36390349-36390371 CTGGAGTCACACAGAGAGGCAGG + Intronic
1172770332 20:37378835-37378857 CTGGAGATAGACAGGGTGGAGGG + Intronic
1172991332 20:39039109-39039131 CTGCAGATAAACAGGGACAAGGG - Exonic
1173039597 20:39449841-39449863 CTGAAGACGCACAGGGTTAATGG + Intergenic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1173709147 20:45139233-45139255 CTGGATACACACTGGGACGAGGG - Intergenic
1173812273 20:45963390-45963412 CTGGTGCCACTGAGGGAGAATGG - Intronic
1175209907 20:57347422-57347444 CTAGAAACAAAAAGGGAGAACGG - Intergenic
1175494837 20:59406688-59406710 CTGTTGTCACACAGGGAGAGCGG - Intergenic
1175640040 20:60621205-60621227 CTGGAGAACCACTGGGATAAAGG + Intergenic
1175751266 20:61499579-61499601 CTGAGGTCACACAGGGAGGAGGG + Intronic
1176139904 20:63540383-63540405 CAGGAGACACACAGGGCTCAGGG + Intergenic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1177849477 21:26329537-26329559 ATGAGGACACACAGGGAAAAGGG - Intergenic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1178738557 21:35175282-35175304 GCCAAGACACACAGGGAGAATGG + Intronic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179486273 21:41712593-41712615 CTGGAGAGACAAAGGGAGGTGGG - Intergenic
1179589241 21:42395160-42395182 CTGCAGAATCTCAGGGAGAAGGG - Intronic
1180038992 21:45266129-45266151 CTGGAGAAACCCCTGGAGAAGGG - Intronic
1180134535 21:45853726-45853748 CTGTACTCACACAGGCAGAATGG - Intronic
1180140863 21:45892781-45892803 CTGAGGACACACAGGTTGAAGGG - Intronic
1180198807 21:46212815-46212837 CTGCAGACAGACATCGAGAACGG + Intronic
1180864120 22:19106040-19106062 CTGGAACCACGCAGGGAGACTGG + Intronic
1181054440 22:20253490-20253512 CTGGAGAAACACCCAGAGAAAGG + Intronic
1181140004 22:20797403-20797425 CTGGGGACACTCCTGGAGAAAGG + Intronic
1181546440 22:23605261-23605283 CTGGGGTCACACAAGGAGAGGGG + Intergenic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1182640704 22:31764745-31764767 ATGGAGAGAAAAAGGGAGAAGGG - Intronic
1182728339 22:32467014-32467036 CTGGAGAAGGACAGGGAGAGAGG - Intergenic
1182924453 22:34109248-34109270 ATGGAGACAGACAGGAAGGAAGG - Intergenic
1182964871 22:34511440-34511462 CTGGGGATACCCAGGGAGAGTGG - Intergenic
1183068350 22:35379296-35379318 GTGGAGCCGCACAGGGACAAAGG - Intergenic
1183109443 22:35638199-35638221 ACAGAGACACACAGGGAGGAGGG - Intergenic
1183192915 22:36333094-36333116 TGGGACACACACAGGGAGCATGG + Intronic
1183428828 22:37753648-37753670 CTAAAGGCACACAGAGAGAAAGG + Intronic
1183469358 22:37997407-37997429 CTGGAGAGAGACAGGGAGCCAGG - Intronic
1183744255 22:39684313-39684335 CTGGAGGCATCCGGGGAGAAGGG - Exonic
1183812035 22:40265741-40265763 CTGGGGTCTCTCAGGGAGAATGG + Exonic
1183986871 22:41574930-41574952 GGGGAGCCACACAGGGTGAACGG + Exonic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
1184186555 22:42868890-42868912 CTGCAGAGAAACAGGCAGAACGG - Intronic
1184588220 22:45462139-45462161 GTGGAGACACACAGAGAGTCTGG + Intergenic
1185102623 22:48849826-48849848 GTGGGGACAGAAAGGGAGAAAGG + Intronic
1185361140 22:50407715-50407737 CTGTGGACACACAGGTAGAGAGG + Intronic
951621629 3:24608271-24608293 CTGGATTCAATCAGGGAGAAAGG - Intergenic
951745450 3:25972819-25972841 CTTGAGACAGAGAGAGAGAATGG + Intergenic
951844027 3:27066171-27066193 CAGGAGAGAGACAGAGAGAAGGG + Intergenic
951966542 3:28391875-28391897 CTAGAGAAAGACAGGAAGAAAGG + Intronic
952098466 3:29984019-29984041 CTGGAAAGTGACAGGGAGAATGG - Intronic
952609644 3:35192658-35192680 CTGCAGATACACAGAGAGCATGG - Intergenic
953768899 3:45763886-45763908 ACGGGGACACACAAGGAGAAAGG + Intronic
953793942 3:45968492-45968514 CTGCAGACAGAGAGGGAGAGGGG - Exonic
953850621 3:46463459-46463481 CTGGACACCCACGGGGAGCAGGG + Intronic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954065784 3:48104820-48104842 CTGAAGACCCACAGTCAGAAAGG + Intergenic
954213434 3:49111167-49111189 CTGGAGATTCGCAGGGAGAGAGG + Intronic
954712668 3:52512805-52512827 CTGCACGCACACAGGGAGCAGGG - Intronic
954749591 3:52806080-52806102 CTGCAGATACAAAGGGAGAGAGG - Intronic
954959350 3:54550549-54550571 TTGGAGACAGACGGGAAGAATGG + Intronic
955465697 3:59235077-59235099 CTAGAGAAACACAGGAAGGAGGG - Intergenic
955569667 3:60291102-60291124 CTGCAGACACACAAGGAGTGAGG + Intronic
955942882 3:64163465-64163487 CTGGAGACTAACAGAGAAAATGG - Intronic
956498621 3:69856521-69856543 ATGGAATCACACAGTGAGAAGGG - Intronic
956702456 3:71970404-71970426 ATGGAGAAAGACAGGGAGACAGG + Intergenic
956890081 3:73604732-73604754 CTGGAGAGAAAGAGGGAGATAGG + Intronic
957167127 3:76689814-76689836 CTGACTACACACAGAGAGAACGG - Intronic
959201113 3:103248983-103249005 CTGCAGACAATCAGGGATAATGG + Intergenic
959537844 3:107507263-107507285 GTGGAATTACACAGGGAGAAGGG + Intergenic
959688926 3:109177522-109177544 CTGGAGACATCCAGGAAAAAAGG + Intergenic
959749356 3:109814778-109814800 CTGGCACCACAAAGGGAGAAAGG - Intergenic
960553276 3:119000705-119000727 TTGAAGACTCAAAGGGAGAAGGG + Intronic
961153702 3:124661220-124661242 CTGGTGACACATAGTGGGAAAGG + Intronic
961786989 3:129353311-129353333 CTGGGGACACACGGGGACCACGG - Intergenic
962832731 3:139158573-139158595 CTGGGGGCACAGGGGGAGAAGGG + Intronic
963734465 3:149004157-149004179 CAGGTGAGAGACAGGGAGAAAGG - Intronic
965420332 3:168449945-168449967 GTGGGGAAACAAAGGGAGAATGG - Intergenic
965784901 3:172325098-172325120 CTGGTCACACACAGGCAGCAGGG - Intronic
966080735 3:175997008-175997030 CCTGAAAGACACAGGGAGAATGG + Intergenic
966494195 3:180560771-180560793 CTGGTGACACCCAGGGAAACAGG + Intergenic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
967521227 3:190435281-190435303 ATGTAGAGACACAAGGAGAAGGG - Intronic
967983548 3:195079409-195079431 CTGAAGAAATACAGGGAAAACGG + Intronic
967997950 3:195180690-195180712 CTGGACACACACAAGCAGACGGG + Intronic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968768134 4:2485464-2485486 TGTGAGACACCCAGGGAGAAAGG - Intronic
969049747 4:4364242-4364264 CTGGGGCCACACAGGAAGATGGG - Intronic
969366297 4:6696356-6696378 CTGAAGTCACACAGGGAGCCGGG - Intronic
969876609 4:10140070-10140092 CTGGAGACGCGCAGGGAGGCTGG - Intergenic
969876613 4:10140089-10140111 CTGGAGACGCGCAGGGAGGCTGG - Intergenic
969876617 4:10140108-10140130 CTGGAGACGCGCAGGGAGGCTGG - Intergenic
969876621 4:10140127-10140149 CTGGAGACGCGCAGGGAGGCTGG - Intergenic
970413894 4:15837622-15837644 CTGGAAAAGCACAGAGAGAAAGG - Intronic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
971954867 4:33403557-33403579 CTGGAGAAAGAGAGGAAGAAAGG - Intergenic
972178641 4:36438708-36438730 CTGGAGAGTGATAGGGAGAATGG - Intergenic
973925330 4:55731133-55731155 CTGGAGAGACACACCAAGAAAGG + Intergenic
974458255 4:62156095-62156117 AGAGAGACACACAGGAAGAAAGG + Intergenic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
975755548 4:77568103-77568125 CTGGTAACACAAAGGGACAATGG + Intronic
975825983 4:78320106-78320128 CTGGAGCCTCCCAGGGAGCAGGG - Intronic
976816130 4:89149671-89149693 GTGAAGACACACAGGGAGGGTGG + Intergenic
978284612 4:107061521-107061543 CTTGAGACAGAAAGGGAAAACGG - Intronic
978591708 4:110330801-110330823 CAGGAGACAAAGGGGGAGAAGGG - Intergenic
979383552 4:120036830-120036852 ATGGACACCCACAGTGAGAAGGG - Intergenic
979641009 4:123012424-123012446 GGGGAGAGACACAGAGAGAAGGG + Intronic
980977933 4:139628890-139628912 CTTGAGAGAGAAAGGGAGAAGGG - Intergenic
981148997 4:141359588-141359610 CAGGAGATACACAGAAAGAAAGG - Intergenic
982131110 4:152229389-152229411 CTGGAGACTCACAGGGACACAGG + Intergenic
982323129 4:154101137-154101159 CTGGAGATACACAGTGAGGTGGG - Intergenic
982400080 4:154956504-154956526 CTTGAGTCCCACAGGGAGAGTGG + Intergenic
983179603 4:164631970-164631992 CTGGAAAGTGACAGGGAGAATGG + Intergenic
983705128 4:170648351-170648373 CTGCAGGCACACTGGAAGAATGG - Intergenic
984372558 4:178885453-178885475 CTGGAAAGTGACAGGGAGAATGG + Intergenic
984555670 4:181211475-181211497 CTGGAGAAACACAGGGCTAGGGG + Intergenic
984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG + Intergenic
985427605 4:189846133-189846155 CGAGAGACACGCAAGGAGAATGG - Intergenic
985727122 5:1522437-1522459 CTCCCGACACACAGGGAGACGGG + Intronic
985867810 5:2529005-2529027 CCTGGGACTCACAGGGAGAAAGG - Intergenic
986673851 5:10166974-10166996 GAGGAGACACACAGGGAAGAAGG + Intergenic
987736171 5:21846367-21846389 ATGCAGACACACAGGGAGTGAGG - Intronic
990136177 5:52646032-52646054 CAGGAGAAAGAAAGGGAGAAGGG - Intergenic
990152429 5:52834423-52834445 GTGGAGAGAGACAGAGAGAAAGG + Intronic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
992409729 5:76493380-76493402 ATGGAGACACACAGGGAAGGAGG - Intronic
993025195 5:82637303-82637325 TGGAAGACACACAGGGAGAAGGG - Intergenic
993206163 5:84881910-84881932 CTGGTGGCAAACTGGGAGAAAGG - Intergenic
993373630 5:87121984-87122006 CTGGATACACTCTGGGAGTAGGG - Intergenic
994491806 5:100456915-100456937 GTAGAGAAAAACAGGGAGAATGG - Intergenic
994551254 5:101238158-101238180 CCTGAAACAGACAGGGAGAATGG - Intergenic
994815112 5:104576189-104576211 GAGGAGAGAGACAGGGAGAAAGG - Intergenic
995125450 5:108573634-108573656 GGGTAGACACACAGAGAGAAGGG + Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
996953207 5:129152779-129152801 CTGGAGATACACAGGCAAACAGG - Intergenic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
998183494 5:139961666-139961688 CTGGTGACACATAGTGGGAATGG - Intronic
998250720 5:140550419-140550441 TTGCAGATACACAGGGAGCAGGG + Exonic
998400851 5:141848437-141848459 GTGGAGATACACAGGCAGACAGG - Intergenic
999275415 5:150326687-150326709 ATTGGGACACACAGGGACAAAGG + Intronic
999410446 5:151345581-151345603 GTGGACACCCACAGGGAGAAAGG - Intronic
999517801 5:152318511-152318533 CCAGAGACACATAGAGAGAAGGG - Intergenic
1000560882 5:162788136-162788158 GTGGAGAGAGACAGGAAGAAAGG + Intergenic
1001769626 5:174283476-174283498 CTGGAGCCAGAAGGGGAGAATGG + Intergenic
1002078837 5:176725956-176725978 CTAGAGACAAAAAGGGAGCATGG - Intergenic
1005200450 6:23338649-23338671 ATGGAGACACACAGGATGTATGG + Intergenic
1005583785 6:27257018-27257040 GTGAAGGCACACAGGGAAAATGG - Intergenic
1007378018 6:41469533-41469555 CTGCAGTCACTCAGGGAGGAGGG + Intergenic
1007458186 6:41997056-41997078 CTGGGGACAGACAGGGATACTGG - Intronic
1008562846 6:52738735-52738757 GGAGACACACACAGGGAGAATGG + Intergenic
1008993996 6:57637094-57637116 CTGGTGATACACAGGCAGACAGG + Intronic
1009893307 6:69715589-69715611 TTGGAGACAGACAGTGTGAAGGG - Intronic
1010155028 6:72782644-72782666 TAGGAGACACAAAGGGACAAGGG - Intronic
1010462561 6:76130041-76130063 CGGGAGACATACAGGAAGAAAGG - Intergenic
1010703906 6:79084756-79084778 CAGCTGACACACAGAGAGAAAGG - Intergenic
1011308188 6:85952511-85952533 CGGGAGACACAGAAGGGGAAGGG - Intergenic
1012019414 6:93898314-93898336 CTGGAGACACAGAGAGACACAGG - Intergenic
1012435021 6:99205807-99205829 CTGGAAAGTGACAGGGAGAATGG + Intergenic
1012629703 6:101449670-101449692 CTGGAGACACAGAGACACAAAGG - Intronic
1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG + Intergenic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1015673140 6:135713670-135713692 CTGGAGACTCGGAGGGAGAGTGG - Intergenic
1015680979 6:135808138-135808160 CTGGAGAGACAGAGGGTGACTGG - Intergenic
1016798520 6:148143967-148143989 CCCCAGACACACAGTGAGAAAGG - Intergenic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017985083 6:159436523-159436545 CTGGAGAGAGACAGCCAGAAAGG + Intergenic
1018706142 6:166464504-166464526 CTGGAGACACACAGTCACCAGGG - Intronic
1018782194 6:167078298-167078320 CTGCATCCTCACAGGGAGAAGGG + Intergenic
1019484890 7:1284916-1284938 CAGGGGACAAGCAGGGAGAAGGG + Intergenic
1019595578 7:1856882-1856904 CTGGGGACACACAGGCAGCGAGG - Intronic
1019685855 7:2381715-2381737 CTGGAGGGACACAGGATGAACGG - Intergenic
1020483549 7:8692389-8692411 CTGGAGAGAAATAGGCAGAATGG + Intronic
1020557883 7:9692486-9692508 CCTGAAACACACAGAGAGAATGG + Intergenic
1021027007 7:15681659-15681681 TTTGAAACACAGAGGGAGAATGG + Intronic
1021249526 7:18306883-18306905 TTGGAAACAGACATGGAGAATGG - Intronic
1021298589 7:18941236-18941258 CTGGAGAGAGGGAGGGAGAAAGG - Intronic
1021345271 7:19519714-19519736 ATTGAGACACAGAGGAAGAAAGG + Intergenic
1021560104 7:21961090-21961112 CCGGTCACACACAGGGAAAAAGG + Intergenic
1021966668 7:25926946-25926968 CAGGAGACAGACAGAGTGAAGGG + Intergenic
1022102334 7:27175869-27175891 CTGGATTCACACTGGGAGGAAGG - Intronic
1022129997 7:27396157-27396179 TTTCAGGCACACAGGGAGAAGGG + Intergenic
1026467089 7:70663439-70663461 GTGGAGCCCCACAGGAAGAAAGG + Intronic
1027943955 7:84722541-84722563 CCTGAGAGCCACAGGGAGAAGGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028421946 7:90642957-90642979 CTGGAGATGCAAAGTGAGAAAGG + Intronic
1028631522 7:92939838-92939860 CCAGAGACACATATGGAGAAAGG - Intergenic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029902854 7:104060316-104060338 CTGGAAAGTGACAGGGAGAATGG + Intergenic
1029969877 7:104778518-104778540 CTGGAGAAACACAGAGTGAAGGG - Intronic
1029969977 7:104779411-104779433 CTGGAGAAACACAGAGTGAAGGG + Intronic
1030074506 7:105724774-105724796 CCAGAGACACACAGGGGAAAAGG - Intronic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030881758 7:114888773-114888795 CTGGAGAAACCCAGCGAGATTGG + Intergenic
1031027426 7:116695514-116695536 CTGGAGTCACACAGCTAGAGAGG + Intronic
1031136244 7:117887424-117887446 CTGGAGACAGACGGGGGGAAAGG - Intergenic
1032088256 7:128894937-128894959 ACAGACACACACAGGGAGAATGG + Intronic
1032547733 7:132757753-132757775 CTGCATTGACACAGGGAGAAAGG + Intergenic
1033211341 7:139462389-139462411 GGGTAGACACACAGAGAGAAGGG - Intronic
1033256565 7:139806653-139806675 CAGGAGACAGAGAGGGAGACAGG - Intronic
1033309076 7:140246716-140246738 GGAGAGACACACAGGGAAAAAGG - Intergenic
1033609851 7:142954544-142954566 CTGGAGAGAAGCAGGGAGCATGG + Intronic
1033645987 7:143304799-143304821 GTGGAGACACACAGGGGTCACGG - Intronic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034392074 7:150794573-150794595 CTGAAGACACACACTGAGGAGGG + Intronic
1034926852 7:155129537-155129559 GTGGAGACACACAGTGTGACTGG + Intergenic
1035078588 7:156198037-156198059 CTGGAGGAACACATGGAGAGAGG - Intergenic
1035090258 7:156304556-156304578 CTGCAGATACAGAGCGAGAACGG - Intergenic
1035340530 7:158157823-158157845 GTGCTGACACACAGGAAGAAAGG + Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1035750372 8:1991947-1991969 CGGTAGACACACAGGGAGGTAGG + Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036149230 8:6282706-6282728 ATGTAGAGACATAGGGAGAAAGG + Intergenic
1036621013 8:10424585-10424607 GTGGAGAGGGACAGGGAGAAGGG + Intronic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1037968198 8:23150033-23150055 CTGGAAACACATAGAGATAAGGG + Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038441359 8:27572934-27572956 GAGGGGACACCCAGGGAGAATGG + Intergenic
1040029698 8:42813467-42813489 CTGGAAACTCACAGGGAGAAAGG + Intergenic
1041185372 8:55294652-55294674 CTGGAGACAGTGAGGGAGTAAGG - Intronic
1041500984 8:58538476-58538498 TGGGAGACAGAGAGGGAGAAGGG + Intergenic
1041708968 8:60876018-60876040 CAGAAGCCAGACAGGGAGAAAGG - Intergenic
1042101626 8:65280813-65280835 TTGGAGACACACAGGGAAGCAGG - Intergenic
1042597671 8:70466880-70466902 CAGGAGAGAGACAGGGAGAGTGG - Intergenic
1043239953 8:77920187-77920209 CAGCACACACACAGGAAGAAGGG + Intergenic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1044799880 8:95943163-95943185 ATGGAGAAACACAGCAAGAAGGG - Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045778397 8:105834391-105834413 CTTGAGACTCTCAGGGAGAAGGG + Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047819105 8:128499040-128499062 CTGGAGACCAAAAGGGACAATGG + Intergenic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1048579178 8:135716789-135716811 CTGCAGACACACAGTGAACAAGG - Intergenic
1048646035 8:136420796-136420818 CTGTAAACACCGAGGGAGAATGG + Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048936517 8:139362149-139362171 CTGGAGACAGCCATGGGGAAGGG + Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049513776 8:143043065-143043087 CTGGTGACGCACAGGGACAGAGG + Exonic
1050169415 9:2799806-2799828 CAGCAGACATAAAGGGAGAATGG + Intronic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1051431321 9:16983695-16983717 CTTGACACACACAGGGATTATGG - Intergenic
1051730636 9:20139286-20139308 CTGAGGACTCACAGGGAGTAAGG - Intergenic
1051891375 9:21945628-21945650 CTGGAAACACCCAGAGAGCAGGG + Intronic
1051974236 9:22929781-22929803 ATGGAGAGAGACAGAGAGAAAGG + Intergenic
1052995256 9:34548558-34548580 ATGGAGACATACAGAGAGACAGG + Intergenic
1054786898 9:69218877-69218899 GTAGACACACACAGTGAGAATGG + Intronic
1055614327 9:78055058-78055080 CTGGTGATACCCAGGGAGACAGG + Intergenic
1057868691 9:98701724-98701746 CGGGAGACACACATGAATAAAGG + Intronic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059955866 9:119515413-119515435 GTGGAGACAGAGAGAGAGAAAGG + Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1061292724 9:129660973-129660995 CTGCAGCCAGCCAGGGAGAAAGG - Intergenic
1061387802 9:130300806-130300828 CTGGAAGCTCCCAGGGAGAAGGG + Intronic
1061542848 9:131287598-131287620 CTGAGGCCACCCAGGGAGAATGG + Intergenic
1062161119 9:135080460-135080482 CTGGACACACGGAGGGAGAGGGG + Intronic
1062349661 9:136132734-136132756 CAGGAGCCGCACAGGGAGGATGG - Intergenic
1186045536 X:5532690-5532712 AGGGAGAGAGACAGGGAGAAAGG + Intergenic
1187166437 X:16808535-16808557 CTGGAGACAAACTGGGTGAGTGG - Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188702732 X:33284631-33284653 CTGGAGACAAGAAGGGGGAAAGG - Intronic
1188974944 X:36661957-36661979 GAGGAGACACACAGGGGGAAAGG + Intergenic
1189571038 X:42297299-42297321 ATATAGACACACAGGGGGAAAGG - Intergenic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1190492611 X:50997981-50998003 AGGCATACACACAGGGAGAATGG + Intergenic
1190681409 X:52830047-52830069 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1190938835 X:55020691-55020713 CTGGAGGTACTCAGGGAGAGAGG + Intronic
1190998502 X:55636087-55636109 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1192084057 X:68078073-68078095 CTGGAGAGAGAGAGAGAGAAGGG - Intronic
1192509293 X:71712508-71712530 AGGGAGACGCACAGGGAGTATGG + Intergenic
1192511427 X:71722654-71722676 AGGGAGACACAGAGGGAGTATGG - Intergenic
1192515270 X:71758851-71758873 AGGGAGACACAGAGGGAGTATGG + Intergenic
1192517404 X:71769045-71769067 AGGGAGACGCACAGGGAGTATGG - Intergenic
1192884178 X:75319854-75319876 CTGGTGACACACAGGAAAACAGG - Intergenic
1193001687 X:76569569-76569591 CTGGAAAGTGACAGGGAGAATGG + Intergenic
1193059134 X:77185984-77186006 CTGGAAAGTGACAGGGAGAATGG + Intergenic
1193228338 X:79012697-79012719 CTGGTGATACACAGGCAGACAGG - Intergenic
1193431735 X:81414880-81414902 CTGAAGACACACTGGCAAAAGGG + Intergenic
1193599227 X:83488727-83488749 CTGGAGTGAAACAGGGAGCAAGG + Intergenic
1193630026 X:83873718-83873740 CTGGAGACTCAAAGGATGAAAGG + Exonic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194341470 X:92711641-92711663 CAGGAGACAGAGAGAGAGAAGGG + Intergenic
1195386152 X:104315039-104315061 CTGTATTCACACAGAGAGAAGGG - Intergenic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1197423897 X:126271994-126272016 CTTGAAAGACACAGAGAGAATGG - Intergenic
1198043626 X:132878323-132878345 CTGGAGGCCCACTGGGGGAATGG - Intronic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1200076280 X:153552883-153552905 ACACAGACACACAGGGAGAAGGG - Intronic
1200649820 Y:5828344-5828366 CAGGAGACAGAGAGAGAGAAGGG + Intergenic
1201321119 Y:12699504-12699526 CTGGAAACACACAGGAACTAAGG - Intergenic
1202075359 Y:21031950-21031972 CTTGAGAACCACAGGGAGCAGGG - Intergenic