ID: 1179440009

View in Genome Browser
Species Human (GRCh38)
Location 21:41386909-41386931
Sequence GTGGAAAAGTGGGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 805
Summary {0: 1, 1: 28, 2: 40, 3: 109, 4: 627}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179440009_1179440015 16 Left 1179440009 21:41386909-41386931 CCTTCCTCATCCCACTTTTCCAC 0: 1
1: 28
2: 40
3: 109
4: 627
Right 1179440015 21:41386948-41386970 AAACCAAAAACCATGGCTTCAGG 0: 3
1: 55
2: 64
3: 69
4: 319
1179440009_1179440014 9 Left 1179440009 21:41386909-41386931 CCTTCCTCATCCCACTTTTCCAC 0: 1
1: 28
2: 40
3: 109
4: 627
Right 1179440014 21:41386941-41386963 AAGACAGAAACCAAAAACCATGG 0: 1
1: 5
2: 83
3: 175
4: 1213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179440009 Original CRISPR GTGGAAAAGTGGGATGAGGA AGG (reversed) Intronic
900166203 1:1245180-1245202 GGGGAAGAGTGGGGGGAGGAGGG - Intronic
900252432 1:1678136-1678158 GGGGAGAAGTGAGACGAGGAGGG - Intronic
900856278 1:5187431-5187453 TTGGAAATGGGGGATGGGGATGG + Intergenic
900921927 1:5678218-5678240 CTTGAGAAGTGGGGTGAGGAAGG + Intergenic
901400399 1:9011604-9011626 GTGGAAAAGTGGAGAGATGAGGG - Intronic
902654926 1:17860530-17860552 GTGGAAAAGTGGAAAGTGAAGGG - Intergenic
902798395 1:18814552-18814574 GTGGGGAAGTGGGAAGAGAAAGG - Intergenic
902870977 1:19313292-19313314 GTGGAAGAGAGAGAAGAGGAAGG - Intronic
903680127 1:25090910-25090932 GAGGCAAAGGGGGATGACGAGGG + Intergenic
903997928 1:27319474-27319496 GCAGAAACGTGGCATGAGGAGGG - Intergenic
904302786 1:29566193-29566215 GTGGAAAAGAGAGGTGAGGAAGG + Intergenic
904390744 1:30184252-30184274 GTGGGAAAGAGGGAGGGGGAGGG - Intergenic
904686804 1:32266655-32266677 GGGGAGGAGAGGGATGAGGAGGG - Intronic
904991278 1:34594859-34594881 GTGGTACAGTGGAATGAGTATGG - Intergenic
905799942 1:40837041-40837063 GGGGAAAAGGGGAAAGAGGATGG - Intronic
905800596 1:40839894-40839916 GTGAAGAAGTGGGGTGTGGAGGG - Exonic
905878979 1:41451223-41451245 GTGGAAATGTGGAGTGAGGCTGG - Intergenic
906069961 1:43008920-43008942 ATGGGAATGTGGGAGGAGGAGGG + Intergenic
906079552 1:43075732-43075754 GTGGAGGAGTGGGAGGAGGGTGG - Intergenic
906302282 1:44691584-44691606 GTAGAGAAGAGGGACGAGGATGG - Intronic
906362654 1:45176888-45176910 GAGCCAAAGTGGGGTGAGGAGGG - Intronic
907680599 1:56559814-56559836 CTGGAAAATGGGGATGAGGAAGG + Intronic
907744167 1:57196056-57196078 GTGGGAGAGTGGGATGAAGAAGG + Intronic
908210315 1:61893896-61893918 GTGGAAAATGGAGAGGAGGAAGG + Intronic
909090052 1:71214560-71214582 GGGGAAAAGTGGGAAGTGGAGGG - Intergenic
909155608 1:72071658-72071680 GTGCAAAAGTGGGATGAGAGAGG - Intronic
909659077 1:78062430-78062452 ATGTAAAAGTGGGTGGAGGAAGG + Intronic
909685110 1:78339294-78339316 ATGGGGAGGTGGGATGAGGAAGG - Intronic
910223728 1:84915837-84915859 GGAGAAAAGTGGGAGGAGGGTGG + Intergenic
910278739 1:85475323-85475345 GAGGAGAAGGGGGAGGAGGAGGG + Intronic
910428351 1:87137945-87137967 ATGGAACAGCGGGATGAGCATGG + Intronic
910832435 1:91474275-91474297 GTGCAAAAGAGGAATGAGAAGGG - Intergenic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911100845 1:94094754-94094776 GGGGAAGAGGGGGAGGAGGAGGG + Intronic
911664105 1:100534891-100534913 GAGAATGAGTGGGATGAGGAGGG + Intergenic
911705896 1:101012342-101012364 GCAGAAAAGAGGGATGAGGAAGG + Intronic
912328038 1:108787407-108787429 GTGGAAAAGAGGGATAAGGAAGG - Intronic
912651016 1:111439611-111439633 GTGGAAATGTGTGATAAGGAAGG - Intergenic
912810438 1:112790153-112790175 GTGGTAAAGTGAGATAGGGAAGG + Intergenic
913120689 1:115737802-115737824 GTGGAAAATTGGGGTAGGGATGG - Intronic
913323714 1:117607781-117607803 GTGGAAAAGGGGGAGGGGGATGG + Intronic
914196779 1:145451871-145451893 CAGGCAAAGTGGGAGGAGGAGGG + Intergenic
914513431 1:148353912-148353934 GAGGAAAAGGGAGAGGAGGAGGG - Intergenic
915254653 1:154617240-154617262 GTGGCAATGAGGGATGAGGTAGG - Intronic
915472896 1:156136380-156136402 GTGGAGGAGGTGGATGAGGAGGG + Exonic
915943396 1:160133251-160133273 GGGGTCAAGTAGGATGAGGACGG + Intronic
916542783 1:165773113-165773135 GTGGAAGATTGGGAAGAAGAAGG + Intronic
916550969 1:165849523-165849545 GAGGTGAAGTGAGATGAGGAAGG + Intronic
916620201 1:166488792-166488814 GTGGGGAAGTTGGAAGAGGATGG - Intergenic
917047632 1:170879778-170879800 GAGGCAATGTGGGATGAGAAAGG - Intergenic
917071072 1:171151608-171151630 GTGTAAAATGGGGATGATGATGG - Intronic
917364603 1:174216151-174216173 GTGGGAAGGTGGGATGGGTAAGG + Intronic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917737342 1:177932937-177932959 GCAGAAGAGTGGGATGAGGAGGG - Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
918497863 1:185159443-185159465 CTGGAAAAGTGAGACGGGGATGG + Intronic
918499627 1:185179449-185179471 GTGGAAAATTGGAATTTGGAGGG + Intronic
918925689 1:190782611-190782633 GGGGAGAAGATGGATGAGGAAGG - Intergenic
919233281 1:194804219-194804241 TTGGGAAAGGGGGATGAAGATGG - Intergenic
920285520 1:204875932-204875954 GGGGAAAAGTGGAAGGAGGAGGG + Intronic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
920898917 1:210087190-210087212 GTGGCGAAGTGGGGTGAAGAGGG - Intronic
922036443 1:221852873-221852895 GTGGGAAAGTGGGAAGGGTAAGG + Intergenic
922068572 1:222168581-222168603 GAGGAAAACTGGGAGGAAGAAGG + Intergenic
923051374 1:230393254-230393276 AGGGAAAAGGGGGAGGAGGAGGG + Intronic
923092992 1:230753697-230753719 CTGGAAAAGTGGGAAGAGGTGGG + Intronic
923191363 1:231623698-231623720 GTGGATGAGAGGGATGAGTAAGG + Intronic
924073512 1:240308509-240308531 GCAGAAAAGAGGGACGAGGACGG + Intronic
924268658 1:242309239-242309261 GCAGAAAAGCGGGATGAGGAAGG - Intronic
924574282 1:245265375-245265397 GTGGACAAGTGGGAGAAGGAAGG + Intronic
924907630 1:248473493-248473515 GTGGATGAGGAGGATGAGGAGGG - Exonic
924916479 1:248574593-248574615 GTGGATGAGGAGGATGAGGAGGG + Exonic
1063225684 10:4013182-4013204 GAGGAAAAGGGGGATGAGGAGGG - Intergenic
1063534679 10:6871825-6871847 GTGCAAAACTGGGACGAGGTGGG + Intergenic
1064008301 10:11715152-11715174 GAGGGAAAGAGGGAGGAGGAAGG + Intergenic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1064714626 10:18163927-18163949 GTGGAATTGTGGGAAGGGGAAGG + Intronic
1065388096 10:25153705-25153727 CTGGAAAAGTGGGCTGCAGATGG - Intergenic
1065511772 10:26486402-26486424 ATGGAAAAATGGGAGGAGTAAGG + Intronic
1065947851 10:30623825-30623847 GTGGACGAGGGGGAGGAGGATGG - Intronic
1066008568 10:31171070-31171092 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1066094236 10:32057066-32057088 GTGGAACAGTAGGGTGAGGAGGG + Intergenic
1066638960 10:37536467-37536489 GCAGAAAAGACGGATGAGGAAGG + Intergenic
1066716248 10:38289529-38289551 GCAGAAAAGTGGGATGAGGAAGG + Intergenic
1067488897 10:46679238-46679260 GTGGAAAGGAGGGATGAGGAAGG - Intergenic
1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG + Intergenic
1067709675 10:48637889-48637911 GTGGAAAAGGGGGAGAAAGAAGG - Intronic
1067859224 10:49827496-49827518 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1067973432 10:50996608-50996630 CTAGAGAAGTTGGATGAGGAAGG - Intronic
1068595103 10:58894802-58894824 GAGTAAAAGAGGGAGGAGGATGG + Intergenic
1069180891 10:65357211-65357233 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1069642354 10:69964064-69964086 GAGGACAAGTGGGATGGCGATGG + Intronic
1069727126 10:70587291-70587313 GTGGGAAGGTGGGCTCAGGAAGG + Intergenic
1070661228 10:78306780-78306802 GTGGAAAAGAGGGTGAAGGAAGG + Intergenic
1070686832 10:78491191-78491213 CTGGACAGGTGGGAAGAGGAAGG + Intergenic
1070946893 10:80399672-80399694 TTGGATATGTGGGATGAGCAAGG - Intergenic
1071541812 10:86492025-86492047 GTGGATACCAGGGATGAGGAGGG - Intronic
1071621330 10:87122497-87122519 GTGGAAAGGAGGGATGAGGAAGG + Intronic
1071689811 10:87805188-87805210 GTGTGAATGTGGGAGGAGGAAGG - Intronic
1071868860 10:89769332-89769354 GCAGAAAACAGGGATGAGGAAGG - Intronic
1071896517 10:90073895-90073917 ATTGAAAAGTGGGGTGAAGAAGG - Intergenic
1071934081 10:90507310-90507332 GTGGAAAAGAGGCATGAGGAAGG + Intergenic
1072563150 10:96595591-96595613 GTGGAACAGGTGGAGGAGGATGG + Exonic
1072688250 10:97551706-97551728 ATGGAAAAGTGGGAAGAGTTTGG - Intronic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1073201672 10:101740530-101740552 TTGGGAAAGTGGGAGGAGAAGGG + Intergenic
1074294837 10:112175561-112175583 GTGTAAAGGTGGGAAGAGGCAGG - Intronic
1074908543 10:117886404-117886426 ATGCAAAAGTGGGATGAGCCAGG - Intergenic
1075126029 10:119699733-119699755 GTGGAAAAGAGGGAACAGGTTGG - Intergenic
1077009862 11:375031-375053 GTGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009874 11:375061-375083 GTGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009886 11:375091-375113 GTGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009916 11:375166-375188 GTGGAAGGGAGGGAGGAGGAAGG + Intronic
1077385106 11:2265723-2265745 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1077676049 11:4193701-4193723 GTGGAAAAATGAGATGGGGAGGG + Intergenic
1077922183 11:6649870-6649892 TTGGAAAAGTGGGAAGCTGAGGG + Intronic
1078417877 11:11180513-11180535 CTGGAAAGGTGGGAGGAGGTAGG + Intergenic
1078442253 11:11377788-11377810 GAGGAAAAGACAGATGAGGATGG + Intronic
1078506175 11:11948403-11948425 GTTTAAAAATGGGATGAGAATGG + Intronic
1078726789 11:13939208-13939230 TTGGAAAAGTGGTATTAGGGTGG + Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078757277 11:14223072-14223094 GTGGAAAAGTGGGCCGAGCATGG + Intronic
1079004069 11:16780269-16780291 GAGGCAGTGTGGGATGAGGAGGG - Intronic
1079173324 11:18116635-18116657 GTAGAAGAGGGGGAAGAGGAGGG + Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080876602 11:36280286-36280308 GTGGGACAGAGGGGTGAGGAGGG + Intronic
1080970143 11:37264404-37264426 GTGGGAAAGTGAGAGTAGGATGG + Intergenic
1081431362 11:42979858-42979880 TTGCCAAAGTGAGATGAGGAGGG + Intergenic
1081830536 11:46108615-46108637 GTTTAAAAGTAGGATGAGAACGG + Intronic
1082203115 11:49397910-49397932 GTTGAGGAGTGGGAGGAGGATGG - Intergenic
1082862841 11:57872134-57872156 GTGGAAGAGAGGGATTGGGAAGG - Intergenic
1083254427 11:61487427-61487449 GTGGAGAAGAGGGATGAGGGAGG + Intronic
1083312276 11:61790204-61790226 TTGGAAAGGTGGTATAAGGAAGG - Intronic
1084443851 11:69192011-69192033 GTGGCAAACTGGGATGAGGATGG + Intergenic
1084458729 11:69284531-69284553 CTGGAAAATTGGGATAATGATGG + Intergenic
1084635491 11:70389647-70389669 GTAGAAAAGAGGGATAAGGAAGG - Intergenic
1085322924 11:75585589-75585611 GTGGAAAACTAGGACGAGGCAGG - Intergenic
1085530268 11:77188233-77188255 GTGGCAAGGTGGGAAAAGGAGGG + Intronic
1086109806 11:83187589-83187611 GTGGAGAAATGGGTTGAAGATGG + Intergenic
1086124049 11:83331655-83331677 GTGCATAAGTAGGATGAGGTAGG + Intergenic
1086329506 11:85739451-85739473 GGGGCAAACTGGGATGAGGGGGG + Intronic
1086651924 11:89302169-89302191 GTGGAGGAGTGGGAGGAGGATGG + Intergenic
1086770170 11:90752479-90752501 GTGGAAAAATGTGGTGGGGAGGG + Intergenic
1087068515 11:94050799-94050821 GTGGAAAGGTGGGAGGAAGTGGG - Intronic
1087080640 11:94168022-94168044 GTGGAGAAGTGGGAGGCAGATGG + Intronic
1087610776 11:100431898-100431920 AAGCAAAAGTGGGATGAGGGAGG + Intergenic
1087615654 11:100483682-100483704 GTGGAAAAGTGAGACAAAGAAGG - Intergenic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1089231405 11:116980332-116980354 GCGGAAAAGAGGGTTGAGGAAGG - Intronic
1089485873 11:118845806-118845828 TTGAAAGAGTGGGATCAGGATGG + Intergenic
1090064106 11:123488668-123488690 GTGGCAACGGGGGAGGAGGAGGG - Intergenic
1090065014 11:123495540-123495562 GTGGAAAAGTGGGGGGAAGTGGG - Intergenic
1090217664 11:124984216-124984238 CTGGAAAAGTGGCATGAGGGAGG + Intronic
1090732787 11:129586157-129586179 GAGGCAAAGTGGGATGGTGACGG + Intergenic
1090746288 11:129707730-129707752 GCGGAAAAGTGGGATGAGGAAGG + Intergenic
1091337223 11:134781514-134781536 GTGGAAAAGAGGAAAGAAGAGGG - Intergenic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091545740 12:1500419-1500441 GCGGGACAGTGGGAGGAGGAAGG - Intergenic
1091555481 12:1570216-1570238 GTGGGAAAGTGAGACAAGGAAGG + Intronic
1091603140 12:1929956-1929978 GAGGAAGAGTGGGATGAAGAGGG + Intergenic
1092521826 12:9283814-9283836 GAGGAACAGCGGGACGAGGAAGG + Intergenic
1093147079 12:15579475-15579497 ATGGAAAAGTGAGAAGAGAAAGG + Intronic
1093551162 12:20413419-20413441 GTGGAAAAGTGGGCTGAGGAAGG + Intronic
1093569969 12:20655520-20655542 GCAGAACAGTGGGATGAGGAAGG - Intronic
1093643463 12:21554983-21555005 GAGGGAAAGTGGGAAAAGGAGGG - Intronic
1094043535 12:26142715-26142737 GAAGAGAAGTGGGTTGAGGATGG + Intronic
1094339388 12:29393639-29393661 GTGGAAGAGGGAGAAGAGGAAGG + Intergenic
1095940283 12:47722417-47722439 CTGTAAAAGTGGGATGATAATGG + Intronic
1096004958 12:48162012-48162034 GTGTAAAAGTGGGAGGAGGTAGG - Intronic
1096019823 12:48314343-48314365 ATGGAAAACTGGGATGGTGACGG - Intergenic
1096247306 12:49999012-49999034 GAGTAAAATTGGAATGAGGAAGG + Intronic
1096374435 12:51096524-51096546 GTGGCAAAGTGGAATGGCGAAGG + Intronic
1097124242 12:56760809-56760831 TTGGACATGGGGGATGAGGAAGG + Intronic
1097277852 12:57825345-57825367 GATGAAAGCTGGGATGAGGAAGG - Intronic
1097788568 12:63789027-63789049 GCAGAAAAGAGGGATAAGGAAGG + Intronic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1097934402 12:65228977-65228999 GTGGCAAAGTGGCAGGTGGAGGG - Intronic
1098203136 12:68078498-68078520 GCGAAAAAGAGGGAGGAGGAAGG - Intergenic
1098239172 12:68448874-68448896 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1098353915 12:69591797-69591819 GCAGAAAAGAGGGAGGAGGAAGG - Intronic
1098573236 12:72012482-72012504 GTGGACAATTGGGAGGAAGACGG + Intronic
1098707793 12:73713329-73713351 AGGGAAAAATGGGAAGAGGAAGG - Intergenic
1098791214 12:74825455-74825477 GTGGAAAATGGAGAAGAGGAAGG + Intergenic
1099174958 12:79410433-79410455 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1099600261 12:84726571-84726593 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1099930353 12:89067118-89067140 GTTGAAAAGTGGAAAGAGGATGG + Intergenic
1100690288 12:97032264-97032286 ATGGTAAAGTGGGAAGAGAAAGG + Intergenic
1101315843 12:103628036-103628058 GGAGATAAGTGGGGTGAGGAGGG - Intronic
1101390524 12:104295663-104295685 TTGGAAAAGTGGGTTGTGGTAGG - Intronic
1102061067 12:109931540-109931562 GTGGAAAAGTGGGCCTAGGGTGG - Exonic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102904377 12:116662878-116662900 GCGGAAGAGGGGGAGGAGGAAGG - Intergenic
1103022639 12:117548324-117548346 GAGGAAAAGGAGGAAGAGGAGGG - Intronic
1103098237 12:118149116-118149138 ATGGAAAAGGGGGACGAGGAAGG - Intergenic
1103607241 12:122096523-122096545 GTGGGACAGTGGGACAAGGAGGG - Intronic
1104040662 12:125128253-125128275 GTGGAAGCGTGGAACGAGGAAGG + Exonic
1104178815 12:126357952-126357974 GGGGAAGAGAGGGAAGAGGAGGG + Intergenic
1104485241 12:129145876-129145898 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1104672932 12:130692798-130692820 ATGGAAAAGTGGGATGGGATGGG + Intronic
1104744178 12:131200841-131200863 AAGGAATAGTGGGATGAAGATGG - Intergenic
1104790201 12:131476382-131476404 AAGGAATAGTGGGATGAAGATGG + Intergenic
1105241125 13:18610262-18610284 GTGGAAGAGTGGGGGGGGGAAGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1106682953 13:32027349-32027371 GTAGCAGAGTGGGATGAGGGTGG - Intergenic
1106900718 13:34352261-34352283 GTGAAAAAGAGGGATGAGGAAGG - Intergenic
1106917711 13:34532856-34532878 GTGGAAAGGGGGTAGGAGGAAGG - Intergenic
1107350916 13:39513952-39513974 GTTGCAGAGTGGGCTGAGGATGG - Intronic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1107581196 13:41788715-41788737 GTGGGATAGTGGTAAGAGGAAGG - Intronic
1107731057 13:43349497-43349519 GTGGAAGAGAGGGAGAAGGAAGG - Intronic
1108231256 13:48344463-48344485 GTGCACAAGTGAGGTGAGGAGGG + Intronic
1108260019 13:48646810-48646832 TTGGAAAATAGGCATGAGGAAGG - Intergenic
1109570545 13:64183374-64183396 GTGGAAAATTGGAAGGAGGAAGG - Intergenic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110233496 13:73191901-73191923 GGGGAACAGTGGGATAAGGCAGG + Intergenic
1110807528 13:79774356-79774378 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1114212503 14:20627038-20627060 GTCAAAAAGTGGCATGAGGCTGG - Intergenic
1114555676 14:23561051-23561073 GTGGGAAAGTGGTATAAGAAGGG + Intronic
1114642834 14:24235844-24235866 CTGGAAAACTGGGATAAGGAAGG - Intronic
1115106108 14:29763451-29763473 GTGGAAAGGAGGGAAGGGGAGGG + Intronic
1115159552 14:30378093-30378115 GTTGAAAAGTGGGGATAGGAAGG - Intergenic
1115320420 14:32075154-32075176 GTGGGAAAGAAGGATGCGGAAGG - Intergenic
1115514632 14:34173327-34173349 CTGGAAAGGTGGTATGAAGATGG - Intronic
1115612918 14:35066115-35066137 GTAGTAAAGTGGCATGATGATGG + Intronic
1115885866 14:37970961-37970983 TTGGAGCAGTGAGATGAGGAAGG - Intronic
1116023208 14:39486011-39486033 CTGGAAAAGGGGCATGAGAATGG - Intergenic
1116994586 14:51309180-51309202 GGGGAAATGTGGGATGGGAAGGG + Intergenic
1117079600 14:52137582-52137604 GTGGAAGAGGGAGAAGAGGAAGG + Intergenic
1117102428 14:52364121-52364143 GCAGTAAAATGGGATGAGGAAGG - Intergenic
1118128368 14:62935069-62935091 GTGGAAAAGTGGGGGGATGAGGG + Intronic
1118872006 14:69750889-69750911 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1120316904 14:82905909-82905931 GTGGCAAAGGCAGATGAGGAAGG + Intergenic
1121233796 14:92377752-92377774 GGGCAAAAGTGAGATGATGAGGG + Intronic
1121603463 14:95223423-95223445 GTGGAAAAATTGGAAGAGAAAGG - Intronic
1121861703 14:97324780-97324802 GAGGAAATGGGGGTTGAGGAAGG - Intergenic
1121920041 14:97872164-97872186 ATGGAACAGTGGGCTAAGGAAGG + Intergenic
1122012292 14:98760188-98760210 GTGGGTATGTGGGGTGAGGAAGG - Intergenic
1122082414 14:99274709-99274731 GAGGAAAAGGGGGAGGAGGAGGG - Intergenic
1122258479 14:100498375-100498397 GTGGAAAAGGGGCATGCAGAGGG - Intronic
1122782659 14:104150182-104150204 GTGGGGGAGGGGGATGAGGAGGG - Intronic
1122907514 14:104808567-104808589 GAGGGAAAGTGGGAGGGGGAGGG - Intergenic
1124204270 15:27703874-27703896 GTGGAACAGGTGGATGAGGGCGG + Intergenic
1124861425 15:33445613-33445635 GTAGAAAAATGGGATGAGGAGGG - Intronic
1124953652 15:34345815-34345837 AGGGAAAAGTGGGGTGAGGGTGG - Intronic
1125344717 15:38707481-38707503 GTGGAAAAGTGAAATGAGGGAGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1126850763 15:52795577-52795599 GTGGAAAAGTGTGAAGGGGAAGG - Intergenic
1126917794 15:53484736-53484758 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1126940845 15:53763374-53763396 GTCGAAAAGTGGAATGAGTTAGG - Intergenic
1127151282 15:56078130-56078152 GAAGAAAAGTGGGATGAGGAGGG - Intergenic
1127755407 15:62087021-62087043 CTGGAACAGTGTGTTGAGGATGG + Intergenic
1127845373 15:62866082-62866104 GTGGAGAAGGTGGATGAGGTTGG + Intergenic
1128252239 15:66171526-66171548 ATGGAGAGGTGGGAGGAGGAGGG + Intronic
1128532381 15:68463336-68463358 GAGGAGATGAGGGATGAGGAAGG + Intergenic
1129820381 15:78597499-78597521 GAGGGAAAGAGTGATGAGGATGG - Intronic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1130018449 15:80205705-80205727 GTGGAAAAGTTGGACTAGGAAGG - Intergenic
1130420088 15:83736828-83736850 GTGGAGAAGTGGGAGGACTATGG - Intronic
1131312606 15:91304566-91304588 GAGAAAAAGAGGGAGGAGGAAGG + Intergenic
1131736616 15:95339398-95339420 ATGGAAAAGAGGGAGGGGGAAGG + Intergenic
1131924865 15:97371604-97371626 CTTGAAAAGTTGGATGAGGCTGG + Intergenic
1133485379 16:6214573-6214595 GAGGCAAAGTGGGAGAAGGAGGG + Intronic
1133825365 16:9273527-9273549 GAGGAAGAGGGGGAAGAGGAGGG - Intergenic
1133853498 16:9527698-9527720 CTGTAAAATTGGGATGATGATGG - Intergenic
1134061155 16:11200468-11200490 GTGGAAGGGTGGGGTGGGGAAGG + Intergenic
1134261042 16:12651021-12651043 GTGGAAAATTGAGAGAAGGAGGG + Intergenic
1134449282 16:14353922-14353944 GGGGGAAAGTGGGGAGAGGAGGG + Intergenic
1134531560 16:14988346-14988368 GTGGAAGAGGGTGATGAGGGAGG + Intronic
1134814009 16:17191107-17191129 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135478174 16:22796536-22796558 GGGGAGAAGTGGGATAAAGAGGG - Intergenic
1135544352 16:23355728-23355750 CAGGGAAAGTGGGATAAGGAAGG + Intronic
1136074330 16:27806492-27806514 GAGGAAAAGTGGGACAGGGATGG + Intronic
1136081342 16:27854319-27854341 AAGGAAAAGGGGGAGGAGGAGGG + Intronic
1136144276 16:28306739-28306761 TGGGAATAGTGAGATGAGGAAGG - Intronic
1136539393 16:30920906-30920928 GTGGAGAAGTGAGATGGGCATGG + Intergenic
1137404530 16:48179206-48179228 GCAGAAAAGTGAGATGAGGAAGG - Intronic
1138171714 16:54856732-54856754 GTGGAAGAATGGAATGTGGATGG + Intergenic
1138326444 16:56175019-56175041 GTGGGAAAGGGGGAGGATGAGGG - Intergenic
1139252096 16:65506337-65506359 GTGGGAGAGTGGGTTGAGGAGGG - Intergenic
1139424964 16:66873799-66873821 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1139548691 16:67661665-67661687 GTGCAGAAGCGGGGTGAGGAGGG + Exonic
1140037355 16:71381573-71381595 GTGGAGAAGTGGGGGGAGGCAGG + Intronic
1140489380 16:75321619-75321641 GCGGAAAAGAGGGGTGAGGAAGG + Intronic
1140917564 16:79507719-79507741 GTAGAAAAGTAGGATGCGGCCGG - Intergenic
1141559451 16:84857406-84857428 TTGGGAAAGAGGGATGTGGATGG - Intronic
1141673304 16:85504187-85504209 TTGGTGAAGTGGGCTGAGGAGGG + Intergenic
1142137821 16:88459719-88459741 GAGGAAGAGGGGGAGGAGGAAGG - Intronic
1142137847 16:88459779-88459801 GAGGAAGAGGGGGAGGAGGAGGG - Intronic
1142498225 17:317658-317680 AGGGAAAACTGGGCTGAGGAAGG - Intronic
1142632061 17:1231498-1231520 CTGGAAAAGTGGGACCAGGACGG - Intergenic
1143335187 17:6166888-6166910 GTGGAGAAGTGAGATTGGGAAGG - Intergenic
1143478742 17:7217235-7217257 CTGCAAAAGTGGGGTGCGGAGGG - Intronic
1143871298 17:9958968-9958990 GTGAACAAGTGGAAGGAGGATGG - Intronic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144344290 17:14336099-14336121 GAGGAAAACTGGGAAGAGCAAGG - Intronic
1144705709 17:17366655-17366677 GTGGAGAAGTGAGATGGTGAAGG + Intergenic
1145774187 17:27515765-27515787 GTAGAAATGTGGATTGAGGAAGG + Intronic
1145894461 17:28445859-28445881 GTTGAGAGGTGGGAGGAGGAGGG - Intergenic
1146473308 17:33141401-33141423 GGGGAAAACTGGGGAGAGGAAGG + Intronic
1146801366 17:35826251-35826273 GGGGAAAGGTCGGGTGAGGAAGG + Intronic
1146940049 17:36838149-36838171 GAGGAAAACTGTGATGGGGAAGG - Intergenic
1147038916 17:37702156-37702178 GGGGAAGAATGGGATGAAGAAGG + Intronic
1148005191 17:44422028-44422050 GTGGAAAAATGGCATTAGAAAGG - Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148863862 17:50618623-50618645 GTGGAATAGAGGGGTGAGGCTGG - Intronic
1148980585 17:51570993-51571015 GTGAAAAAGTGAGATGGAGATGG - Intergenic
1149364107 17:55923533-55923555 TTGGGAGAATGGGATGAGGATGG - Intergenic
1150520076 17:65857173-65857195 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1150585066 17:66510082-66510104 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1150919406 17:69467444-69467466 GGGGGAAAGTGGGAGGAGAATGG + Intronic
1150919544 17:69468740-69468762 GCAGAAAAGAGGGATGATGAAGG - Intronic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151120402 17:71786794-71786816 GTGAAAAAGAGGGATCAGGAAGG - Intergenic
1151223396 17:72630711-72630733 GTGGAAAGATGGGAGGAGGCAGG + Intergenic
1151445916 17:74163931-74163953 GAGGAAAACTGGGAGGAGGCAGG - Intergenic
1151657939 17:75504330-75504352 ATGGAAAGGTGGCAGGAGGAAGG + Intronic
1151672482 17:75579059-75579081 GTGGGAAAGTGGGAAGCAGAGGG + Intergenic
1152368320 17:79870220-79870242 GAGGGGAAGTGGGAGGAGGAAGG - Intergenic
1152379773 17:79936423-79936445 GTGTAAAACTGTCATGAGGATGG - Exonic
1152410550 17:80120538-80120560 GAGGTGAAGTGGGATGGGGACGG - Intergenic
1153014827 18:574070-574092 ATGGAAAAGTGTGAGGAGGAAGG - Intergenic
1153092275 18:1360945-1360967 GTGGAAGACTGTGAAGAGGATGG - Intergenic
1153109708 18:1570681-1570703 GTAGAAAAGTGGGGTGTTGAAGG + Intergenic
1153269975 18:3310748-3310770 GTGGAAAAGAGGAGTGAGGGAGG + Intergenic
1155242355 18:23875847-23875869 GTGGAGATGGGGGATGAGAAGGG - Intronic
1155505854 18:26532087-26532109 GTGGTATGCTGGGATGAGGATGG + Intronic
1155576399 18:27252488-27252510 GTGGTAAACTGGGAGGAGGGGGG + Intergenic
1156316102 18:35970547-35970569 ATGGAAAGGTGGGAAGAGCAGGG + Intergenic
1156491374 18:37498403-37498425 GGGGAGAAGAGGGAAGAGGAGGG - Intronic
1156591230 18:38490945-38490967 GTGGAACAGGGGCAGGAGGAAGG - Intergenic
1156790446 18:40966623-40966645 GGGAAAGAGTGGGATGGGGATGG - Intergenic
1156796638 18:41053897-41053919 GTGAAATAAAGGGATGAGGAGGG - Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157673134 18:49547587-49547609 GAGGTAAAGTATGATGAGGAAGG + Intergenic
1157763835 18:50283173-50283195 AAGGAAAAGTGAGGTGAGGAAGG + Intronic
1157795362 18:50569619-50569641 GCGGAAAACAAGGATGAGGAAGG - Intronic
1157927456 18:51781816-51781838 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1158542599 18:58370215-58370237 GGGGGAGAGTGGCATGAGGAGGG - Intronic
1158927311 18:62281015-62281037 GTAGAAAAGAGGGAAGAGGAAGG - Intronic
1159215236 18:65383895-65383917 GTGGGACAGTGGGAGGAGAAGGG + Intergenic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1160102410 18:75935350-75935372 ATGGAGAAGTGAGATCAGGAGGG + Intergenic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161415663 19:4145236-4145258 GGGGAGGAGTGGGAGGAGGAGGG + Intergenic
1162171753 19:8795251-8795273 GCAGAAAAGAGGGATGAGGATGG - Intergenic
1162492070 19:10998816-10998838 GAAGAAAAGTCTGATGAGGAAGG - Intronic
1162919793 19:13893964-13893986 TTGAAAGAGTGGGATGGGGATGG + Intronic
1163018542 19:14471054-14471076 GTGGAGATGTGGGATTAGGAGGG - Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163636106 19:18437837-18437859 GTGGACCAGGGGGCTGAGGAAGG - Intronic
1163779166 19:19237197-19237219 AAGGAAAAGTAGGCTGAGGATGG - Intronic
1165064475 19:33221015-33221037 GGGAAGAAGTGGGAGGAGGAAGG - Intronic
1165233122 19:34399859-34399881 AGGGAAGAGTGGTATGAGGAAGG - Intronic
1166649981 19:44565718-44565740 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1167983308 19:53294287-53294309 GCAGAAAAGAGGGTTGAGGAAGG + Intergenic
1168243852 19:55100207-55100229 GAAGACAAGTGTGATGAGGAGGG - Intronic
1168352840 19:55686416-55686438 GGGGATACGTGGGATGGGGAGGG + Intronic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
925189956 2:1874807-1874829 GTGGAAATGGGGCAGGAGGATGG - Intronic
925266443 2:2569686-2569708 GTGGAACAGTGGGCTGGGCAGGG + Intergenic
925599765 2:5596348-5596370 GTGAAGAAGTGGGAGGAGGCTGG - Intergenic
925724275 2:6858043-6858065 GTGGATGAATGGGAAGAGGAAGG - Intronic
926215161 2:10901808-10901830 GTGGGGAAGGGGGATGATGAGGG + Intergenic
926756778 2:16242918-16242940 GTGGAAATGAGGGAGGAAGAAGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927074537 2:19564736-19564758 TTTGAAAAGTGTGGTGAGGATGG + Intergenic
927416263 2:22883817-22883839 ATGGAAAAAAGGGAAGAGGAGGG + Intergenic
927955651 2:27205661-27205683 GTATAAAAGAGGGATGACGAAGG + Intronic
928218197 2:29380073-29380095 GAGGAAAAGAGCAATGAGGAAGG + Intronic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
928756282 2:34529509-34529531 GTGGAAAAGGGTGATGGGGAAGG - Intergenic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929273916 2:40005061-40005083 GTGGAGAAGTTGTCTGAGGATGG + Intergenic
929552542 2:42903666-42903688 GTGGAAAGCTGGGAGAAGGAAGG + Intergenic
929776865 2:44935477-44935499 GTGGAGCCGTGGGATGAGGGGGG - Intergenic
929904765 2:46036217-46036239 AGGGGAAAGTGGGATGAGGTGGG + Intronic
929966408 2:46540755-46540777 GTGTATATGTGGGATGGGGAGGG - Intronic
930158400 2:48128497-48128519 GAGGAAATGGGGGAGGAGGAAGG + Intergenic
930589125 2:53306061-53306083 CTGAAAAATTGGGAGGAGGAAGG + Intergenic
930664426 2:54088112-54088134 CTGGAAAGGTGAGAAGAGGAGGG + Intronic
930735685 2:54776208-54776230 GTGGAAAAGGAGGAGGAGAAAGG + Intronic
931208205 2:60167862-60167884 GTAGGAAAGAGGGATCAGGAGGG + Intergenic
931543873 2:63359078-63359100 GAGGGAAAGTGGAAAGAGGAAGG - Intronic
931624589 2:64245329-64245351 GTGGAAATGGGGGATGGGGAAGG - Intergenic
931639504 2:64369622-64369644 GAGGATAAGTGGGAGGAGGGGGG + Intergenic
932014101 2:68006963-68006985 GTGGAAAAGTGAGACCAGGAAGG + Intergenic
932169403 2:69539823-69539845 CTGGAAAAGTGGGATTTTGAAGG - Intronic
932879569 2:75488569-75488591 GTAGAAAAGTGGGAGAAAGAAGG + Intronic
932981129 2:76668289-76668311 GTGGCAAAGTGTGAAAAGGAAGG - Intergenic
933262182 2:80142934-80142956 GTGGAAAAGAGAGATGAAAAGGG + Intronic
933759037 2:85661832-85661854 ATGGAAAAGGGGGATGGGAAGGG - Intronic
934924670 2:98373926-98373948 CTGGAGAAGTGGGATGAAAATGG - Intronic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935002004 2:99027371-99027393 GTAGAATGGTGGGAGGAGGAAGG + Intronic
935163387 2:100548583-100548605 GCAGAAAAAAGGGATGAGGAAGG - Intergenic
935279653 2:101506452-101506474 GTGGAAGAGGAGGATGGGGAAGG + Intergenic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
935696174 2:105772872-105772894 GTGGACACGTGGGATGATGTGGG - Intronic
935901130 2:107794998-107795020 GTGGGATAGTGGGATGAGGAGGG + Intergenic
936770368 2:115905670-115905692 GTTGAAAAGGGGGATGTGGTGGG - Intergenic
937060890 2:118979723-118979745 GAGGAAATTTGGGAAGAGGAGGG - Intronic
937318153 2:120945073-120945095 GAGGGAAAGAGGGAAGAGGAAGG + Intronic
939422837 2:141995911-141995933 GTGGAAAAGAGGGAAGAAAAAGG + Intronic
940120685 2:150261288-150261310 GTAGGGAAGTGGGATGGGGAGGG + Intergenic
940407008 2:153316296-153316318 TTGGATAATTGGGATTAGGAGGG - Intergenic
940553723 2:155195002-155195024 TTGGGAAAGTGGGATGGGGTGGG + Intergenic
940567748 2:155389423-155389445 GTGAATATGTGGGAGGAGGAAGG + Intergenic
940678383 2:156752909-156752931 GCAGAAAAGAGGGACGAGGAAGG - Intergenic
941138081 2:161741948-161741970 GGGGAAAGGTGGAATGAAGATGG - Intronic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
941591148 2:167422123-167422145 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
942029426 2:171944249-171944271 GGGGAAAAGTTGCATGTGGACGG - Intronic
942541177 2:177016953-177016975 GGAAAAAAGTGGGAAGAGGAGGG - Intergenic
943000919 2:182327804-182327826 GGAGAAATGTGGGTTGAGGAGGG + Intronic
943236853 2:185332753-185332775 GTGGAAAAGTAGACTGAAGAAGG + Intergenic
943321652 2:186451541-186451563 GTGGAAAAGTGACACAAGGAAGG + Intergenic
943458706 2:188142061-188142083 TTGGAAAAGTGAGGTGATGAAGG + Intergenic
943764626 2:191647428-191647450 GTGTAAAAGTGGGAGGAGCAGGG + Intergenic
945459728 2:210091784-210091806 ATGGAAAATTGGGATGAAGAAGG - Intronic
946313614 2:218896261-218896283 AGGGAAAAGTAGGAGGAGGAAGG + Intronic
946717076 2:222563921-222563943 GAGGAAGAGAGGGAAGAGGAGGG + Intergenic
947154611 2:227149421-227149443 GCAGAAAAGAGAGATGAGGAAGG - Intronic
947233886 2:227920031-227920053 ATGGAAAAGTGGGGTGTGGGAGG + Intronic
947619196 2:231577796-231577818 GTGGGAAAGTGGGCCGAGGCTGG + Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948989815 2:241548109-241548131 GGGGTAAAGTGGGAGGAGGATGG - Intergenic
949048685 2:241885230-241885252 GTGGCAGAGTGGGAGGGGGAGGG + Intergenic
1169651321 20:7870892-7870914 GTGGAGAAGAGGGAAGAGAAGGG - Intergenic
1169850034 20:10037992-10038014 ATGGTAAAGTGTGATGAGGAGGG + Intronic
1169864525 20:10185673-10185695 GTGGTAAGGTGGAAGGAGGAAGG + Intergenic
1169991833 20:11513241-11513263 GGGGAAAGGTGGGGAGAGGATGG - Intergenic
1170129970 20:13008922-13008944 GTGGCAAAGTGTGAGGAGGCGGG - Intergenic
1170441789 20:16386652-16386674 GTGAAAAAATGGGAAGAGGCTGG + Intronic
1170559439 20:17544116-17544138 GTGGGGAAGTGAGATGGGGAAGG + Intronic
1170991384 20:21304551-21304573 GTGGAGAAATGGGATGAGAAGGG - Intronic
1171416215 20:24982411-24982433 GTAGAAAAGCCTGATGAGGAAGG - Intronic
1172247732 20:33457421-33457443 GTGGGAAGGTGGGAATAGGATGG + Intergenic
1172580830 20:36046556-36046578 GTGGAAGAGGGAGAAGAGGAAGG - Intergenic
1172602586 20:36194265-36194287 GGTGACAAGCGGGATGAGGATGG + Exonic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1172736345 20:37128709-37128731 GCGGAAAAGAGGTATGAGGAAGG - Intronic
1172869522 20:38127034-38127056 GTGGGAAAGAGGCCTGAGGAGGG + Intronic
1172953228 20:38735910-38735932 GTGGAGAAGTGAGACGGGGAAGG + Intergenic
1173037256 20:39424377-39424399 GTGGAAATGGGGGATGAGAAAGG + Intergenic
1173201532 20:40958786-40958808 GTGGGAAAGCGGGATGGGGAGGG - Intergenic
1173304125 20:41831663-41831685 GTGGAAAAGTAGGATGTATAGGG + Intergenic
1173308793 20:41877261-41877283 GTGGAAAAGTGGGACAGAGAAGG - Intergenic
1173465956 20:43281620-43281642 GAGGGGAAGTGGGATGGGGAAGG - Intergenic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1174122061 20:48273257-48273279 GGGGAAAAGTGGGAGAGGGAAGG + Intergenic
1174357809 20:50010056-50010078 GTGGAAAATTCGGAGGTGGAAGG + Intergenic
1174917968 20:54673010-54673032 GTGGAACACTGGGATCAGGAAGG + Intergenic
1175120149 20:56710796-56710818 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120174 20:56710871-56710893 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120200 20:56710946-56710968 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175244198 20:57571804-57571826 GTTGAAAAGAGAGCTGAGGAAGG + Intergenic
1175465872 20:59191189-59191211 GTGGTACAGTGGGATGGGCAGGG - Exonic
1175906967 20:62385513-62385535 GTAGAACAGTGGGAGGAGGGGGG + Intergenic
1176033761 20:63026469-63026491 GTGGAAAGGTGAGAAGATGAAGG - Intergenic
1177758269 21:25373602-25373624 GTGGGAGAGGGGGAGGAGGAGGG - Intergenic
1178697148 21:34803182-34803204 TTGGAAATTTGGGATTAGGATGG + Intronic
1178946101 21:36949073-36949095 GTGGAATGGGGGGATGAGGTGGG - Intronic
1178989530 21:37341346-37341368 GAGAAAGAGTGGGAGGAGGAGGG - Intergenic
1179078831 21:38150959-38150981 GTGTGATAGTGGGAGGAGGATGG + Intronic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1180041198 21:45281127-45281149 GTGGAAAAGGAGGCTGATGATGG - Intronic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1181780867 22:25192236-25192258 GTGGAAAGGGGAGGTGAGGAGGG - Intronic
1181905652 22:26193596-26193618 TTGGTGCAGTGGGATGAGGATGG - Intronic
1182558557 22:31141942-31141964 GTGGAAAAGGGGGCAGAGGTGGG - Intergenic
1183652998 22:39169754-39169776 CTGGAAAAAGGGGAGGAGGAGGG - Intergenic
1183810999 22:40257357-40257379 TAAGAAAAATGGGATGAGGAAGG + Intronic
1184717707 22:46291296-46291318 GTGGACAGGAGGGCTGAGGATGG + Intronic
1184797009 22:46738383-46738405 GGGGAGAAGAGGGAGGAGGAAGG + Intergenic
1184901991 22:47452034-47452056 GGGGAGAAGGGGGACGAGGATGG - Intergenic
1184949929 22:47834051-47834073 TTGGAAAAGTGGCAAGAGGAAGG + Intergenic
1185009666 22:48306045-48306067 GTGGACAGGTGAGATGTGGATGG + Intergenic
1185055980 22:48578574-48578596 ATAGGAAGGTGGGATGAGGATGG + Intronic
1185311799 22:50160199-50160221 GGGGAGAAGGGGGAGGAGGAAGG - Intronic
1185328586 22:50240333-50240355 GTGGATCAGTGGGAAGACGAAGG - Exonic
1185372518 22:50467635-50467657 GAGGAAGAGGGGGATGAGGGAGG - Exonic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950626442 3:14250889-14250911 GCGGAAAAGAGGGATGAGGAAGG + Intergenic
950889100 3:16387344-16387366 GTGGGAAAGTGGGGAGAGGGTGG - Intronic
950979438 3:17286789-17286811 ATGGAAAGGTGGTCTGAGGATGG + Intronic
951005449 3:17610481-17610503 TTGAAAAAGTGGGAAGAGGCTGG - Intronic
951089630 3:18557057-18557079 GTGGAATGCTGGGAGGAGGAGGG + Intergenic
952606146 3:35149125-35149147 GGGTAAGAGAGGGATGAGGAAGG - Intergenic
952798347 3:37263389-37263411 GCGGGAAAGAGGGATGAGGAAGG + Intronic
953386412 3:42508733-42508755 GAGAAAAGGTGGGAGGAGGAAGG - Intronic
953578738 3:44134486-44134508 GTGGGAAAGTGGGATGTGGAAGG + Intergenic
953887006 3:46719797-46719819 GAGGAAAACTGGGCTCAGGAAGG + Exonic
954091686 3:48289395-48289417 GTGGAAAGGTGGATTGAGGGAGG + Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
955191421 3:56765295-56765317 GCGGAAAAGAGGGATAAGGAAGG + Intronic
955349584 3:58183813-58183835 GGGGAAATGTGGCAGGAGGAAGG + Intergenic
955651683 3:61201591-61201613 ATGGAATAGAGGGATGTGGAGGG - Intronic
955731939 3:61996367-61996389 GTGTAAATATGGGATGATGATGG + Intronic
956572167 3:70709000-70709022 GTGGAAGAGGGGGAGGAGGTGGG + Intergenic
956741402 3:72279142-72279164 GTGGAAAAGAGAGAAAAGGAAGG + Intergenic
956824792 3:72987901-72987923 GTGGGGAAGTGTGATGGGGATGG - Intronic
957122415 3:76112017-76112039 GTTTAAGAGTGGGATGAGGTTGG - Intronic
957531799 3:81450115-81450137 TTGGAAAAATGGGATAAGGGGGG + Intergenic
957944377 3:87043931-87043953 GTGGAAAAGAGGGATGAGAAAGG + Intergenic
958260586 3:91376075-91376097 GTGAAAAGCTGGGATGATGAGGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
959550623 3:107651933-107651955 GCAGAAAAGAGGGCTGAGGAAGG + Intronic
960157238 3:114308514-114308536 GTGAAAAAATGAGATGAGGATGG - Exonic
960461190 3:117937894-117937916 GTAGAAAAGTGGTATGAGGGTGG - Intergenic
960489814 3:118302122-118302144 GTGAGAAAGTGGGACCAGGAAGG - Intergenic
960680633 3:120243906-120243928 GAGGGAAAGGGGGATGAGGAAGG - Intronic
960970854 3:123139234-123139256 GTGGGACAGTTGGAGGAGGAGGG - Intronic
961137369 3:124524287-124524309 AGAGAAAAGTGGGATGAGGAAGG + Intronic
962109625 3:132430657-132430679 GTGGAACAATGGGAAGAGAAAGG - Intronic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962448585 3:135492207-135492229 GTGGAAAATTAGGGTGAGAACGG + Intergenic
962627064 3:137236290-137236312 GTGGAAAAGTGAGACTAGGAGGG - Intergenic
963963701 3:151340889-151340911 CAGGAAATGTGGGATGAGGATGG + Intronic
964066661 3:152587991-152588013 GTGGCAAAGTAGGAAGAGCAAGG - Intergenic
964261912 3:154849023-154849045 GTGGAAAAGGTGGAGAAGGATGG + Intergenic
964261923 3:154849100-154849122 GAAGAGAAGGGGGATGAGGAAGG + Intergenic
964920748 3:161892567-161892589 GTGGAAAAGGGGAAGGAGAAAGG + Intergenic
967132923 3:186489096-186489118 CTGGCTATGTGGGATGAGGAGGG - Intergenic
967440021 3:189496360-189496382 GTGGGATTGTGGGATGGGGAAGG + Intergenic
968038530 3:195569044-195569066 GTGAAAAAGTTGGATGATGCAGG + Exonic
968410627 4:386813-386835 GTGGGAAAGTGGGAGCGGGAGGG - Intergenic
968426118 4:524499-524521 GAGAAAGAGAGGGATGAGGAGGG + Intronic
969113751 4:4859314-4859336 GCGGAAAAGAGGGCTGAGGAGGG + Intergenic
969218339 4:5741408-5741430 ATGGAAATGGGGGATGTGGAGGG + Intronic
969403457 4:6972670-6972692 GCGGAAAAGAGGGATGAGGAAGG + Intronic
969761112 4:9182894-9182916 GGGGAAAAGTGATATGAAGAAGG + Intergenic
969832202 4:9806968-9806990 CTGGAAAAGTGGGCTGAGAAGGG - Intronic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
970457004 4:16234435-16234457 ATGGAAAACTGGGCTGAGGACGG + Intergenic
970674100 4:18429189-18429211 GTGGAAAAAAGGTATGAGGTTGG + Intergenic
970725299 4:19036799-19036821 GTGGGAAAGTGGAAAGAGAAAGG - Intergenic
970807141 4:20050239-20050261 GAGGAAAAATAGGAAGAGGAGGG - Intergenic
971268571 4:25115849-25115871 GTGGAAAAAGGGTAAGAGGAGGG - Intergenic
971357985 4:25912259-25912281 GGGAAGAAGTAGGATGAGGATGG + Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973530897 4:51835961-51835983 GTGGAGCAGTGGGAGGAGGAAGG - Intergenic
973687446 4:53386894-53386916 GTGGAAAAGAGGGGTGATAAAGG + Intronic
973865850 4:55112244-55112266 GAGGAAAAGGGGGAAGAGGAGGG - Intronic
974061670 4:57041443-57041465 GTTGAAAAGGGTGATGAGGCAGG + Intronic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
975233466 4:71962632-71962654 GTGGAAGAATGGGGTGAGGGAGG - Intergenic
975264544 4:72346845-72346867 GGAGAAAAGTGAGATGAAGAGGG - Intronic
975857862 4:78643518-78643540 GTGGTAGAGTGGAATGAGCATGG - Intergenic
975979841 4:80144888-80144910 GTGGGGAAGTGAGATGAGGAAGG - Intergenic
977200785 4:94112910-94112932 ATGGAAAAGAGGGAGGGGGAGGG + Intergenic
977578067 4:98695789-98695811 GTGGAAAAGAGATATAAGGAAGG + Intergenic
977865773 4:102025762-102025784 GAGAAAAAGTGGGAGAAGGAAGG - Intronic
978534600 4:109747781-109747803 GTGGAAAACTCGGGGGAGGAGGG + Intronic
979001074 4:115220597-115220619 GTGGAAAACAGGGATAAGGAAGG + Intergenic
979356736 4:119713894-119713916 GTGGAAATGTGGGCTCAAGATGG - Intergenic
979733427 4:124052590-124052612 GGGGAAGAGGGGGAAGAGGAGGG + Intergenic
981800546 4:148650405-148650427 GTGGAAAAGTGTGAAGAGATTGG + Intergenic
982141489 4:152324465-152324487 GTAGGAAAGGGGGAAGAGGATGG + Intronic
983470939 4:168153343-168153365 GCAGAAAAGAGGGATGGGGAAGG - Intronic
983843279 4:172482748-172482770 GTGGAAAAGATGAATGATGAAGG - Intronic
983907337 4:173197773-173197795 GTGCAATAATGGGAGGAGGATGG + Intronic
984968494 4:185164598-185164620 GCAGAAAAGAGAGATGAGGAAGG - Intronic
985331442 4:188841151-188841173 ATGGAAAAGAGAGATGTGGAGGG + Intergenic
985784994 5:1888753-1888775 GAGGAAAAGAAGGATGAGCAAGG - Intergenic
986896877 5:12381862-12381884 GCAGAAAAGTGGAATAAGGAAGG - Intergenic
989308047 5:39980329-39980351 GTGGTAAATAGAGATGAGGAAGG - Intergenic
989349211 5:40465789-40465811 CTGGAAAGGTGGGATGAAGTGGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990087621 5:51998180-51998202 GGGAAAAAGTGGGATGAGAGGGG + Intergenic
990186703 5:53217963-53217985 GAGGAGAAGGGGGAAGAGGAGGG + Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
991261878 5:64676692-64676714 AAGGAAAAGAGGGATGAGGAAGG - Intergenic
992023930 5:72652433-72652455 GTGGAGAAGTGGGACAAGGATGG + Intergenic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992763125 5:79969435-79969457 GTGGAAAGGTAGGAAGAGAATGG - Intergenic
992865461 5:80953038-80953060 GTGGAATAATGAGGTGAGGAGGG + Intergenic
993111214 5:83659478-83659500 GGGGAAAAGTGTGTAGAGGAAGG + Intronic
993412491 5:87591186-87591208 TTGGAAAAGAGGTATGTGGATGG - Intergenic
993424256 5:87742828-87742850 GTGGAAAGAGGGGAAGAGGAAGG - Intergenic
994336690 5:98575675-98575697 GTGGACAAGTGGTATGGAGAAGG - Intergenic
995122017 5:108546301-108546323 GAGGAAAAGCAGGATGAGAACGG - Intergenic
995403480 5:111767582-111767604 GTGGAAGAGGGAGTTGAGGAAGG - Intronic
995454374 5:112336088-112336110 TTGGATAAGTGGGATGGGAAGGG + Intronic
995875303 5:116783262-116783284 GCTTAAAAGTGGGGTGAGGAGGG - Intergenic
996212289 5:120826273-120826295 GTGGTAAAGTGAGAAGATGAAGG + Intergenic
996777823 5:127152048-127152070 GTGGAAAAGTTCAAAGAGGAAGG + Intergenic
997192815 5:131954833-131954855 GGGGAAAAGTGGGTGGAGAAGGG + Intronic
997691660 5:135831519-135831541 GTGGCATAGGGTGATGAGGAAGG + Intergenic
998194767 5:140058775-140058797 GAGGAAAAGGAGGAAGAGGAAGG - Intergenic
998794640 5:145805196-145805218 ATGGAAATAAGGGATGAGGAGGG - Intronic
998902340 5:146869665-146869687 GTAGGAAAGTGGGATGGGCATGG + Intronic
999482320 5:151960031-151960053 GTGAAAAAGAGGGATGAGGGAGG + Intergenic
1000125270 5:158237606-158237628 CTGGAGAAGTGGGGTGTGGAGGG + Intergenic
1000268949 5:159664726-159664748 GTGGAAAAGGAGCATGAGGGAGG - Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001652941 5:173328280-173328302 AAGGAAGAGTGGGAGGAGGAGGG - Exonic
1001817085 5:174678692-174678714 GCCAAAAAGAGGGATGAGGAAGG + Intergenic
1001886929 5:175301055-175301077 GTGGAAAAGTGCGATTAACAGGG + Intergenic
1002374985 5:178782257-178782279 GTGGATGCGTGGAATGAGGAAGG - Intergenic
1002893471 6:1357748-1357770 GTTGAAAAGGAGGAAGAGGAGGG - Intergenic
1003067992 6:2919600-2919622 CTGGCAAAGTGAGATGTGGAGGG + Intergenic
1003232506 6:4267445-4267467 GAGGAAGAGAGGGAAGAGGAGGG + Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1004266431 6:14152007-14152029 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1004362757 6:14985811-14985833 GTGGCAAATAGGGATGGGGAGGG - Intergenic
1004525575 6:16404402-16404424 AGGGAAAGGTGGGATGAAGAGGG - Intronic
1004900310 6:20187493-20187515 GTGGGAAAGTGGGAAGGAGAAGG - Intronic
1005419260 6:25631912-25631934 GTGCAAAAGAGGGATGACTAGGG + Intergenic
1005976198 6:30801627-30801649 GTGGAGAAGTGGGCAGAGGAAGG + Intergenic
1007353714 6:41294629-41294651 CTGGTAAAGTGGCATGGGGAAGG - Intergenic
1007380786 6:41488832-41488854 GGGAGAAAGTGGGAGGAGGAGGG + Intergenic
1007897111 6:45374079-45374101 ATGAGAAAGCGGGATGAGGATGG + Intronic
1008554696 6:52663597-52663619 GCTGAAAAGAGGGATGAGGAAGG + Intergenic
1008759395 6:54835421-54835443 GGGTAACAATGGGATGAGGAAGG + Intergenic
1008878201 6:56352322-56352344 GTGGACAAGTGGGAGAAGAATGG + Intronic
1008994629 6:57644305-57644327 GTGAAAAGCTGGGATGATGAGGG - Intronic
1009183172 6:60543128-60543150 GTGAAAAGCTGGGATGATGAGGG - Intergenic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009888442 6:69652877-69652899 GTGCTAAAGTGGGCTGAAGAGGG - Intergenic
1010744371 6:79544119-79544141 ACAGAAAAGAGGGATGAGGAAGG - Intergenic
1011064300 6:83308934-83308956 GTGGAAAACTGGGCAGAGGCAGG + Intronic
1011259069 6:85453115-85453137 GCAGAAAACTGGGAAGAGGATGG + Intronic
1011501076 6:87990707-87990729 GTGGTAATCTGGGGTGAGGAAGG + Intergenic
1012032957 6:94096558-94096580 GTGGAAGATTGGGATATGGAAGG + Intergenic
1012044359 6:94250871-94250893 GTGAAAAAGTGGAATAAAGATGG - Intergenic
1012271841 6:97222695-97222717 ATGAAAAAGGGGGATGGGGAGGG + Intronic
1013049404 6:106517624-106517646 GGGGAAAGTAGGGATGAGGATGG - Intronic
1013986890 6:116205136-116205158 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1014637481 6:123866241-123866263 GTGTAATAGTCAGATGAGGATGG - Intronic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015017591 6:128433247-128433269 GTGGAAAGCGGGGATGAAGAGGG - Intronic
1015335109 6:132028002-132028024 GCGGAAGAGAGAGATGAGGAAGG + Intergenic
1015442838 6:133268807-133268829 GAGGGAGAGTGGGAGGAGGAAGG + Intronic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1017804008 6:157927113-157927135 ATGGAAAACTGGAAAGAGGAAGG + Exonic
1018285878 6:162237017-162237039 TTCGAATAGTGGGAGGAGGATGG - Intronic
1019302841 7:317394-317416 GGGGAAAAGTGGGATGAGCCTGG - Intergenic
1019494936 7:1333395-1333417 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1019551704 7:1606592-1606614 GGGGAAGAGTGGGAGGAGAAGGG - Intergenic
1020342669 7:7129504-7129526 GTGGCACAGTGGGTTAAGGAAGG - Intergenic
1021056451 7:16053297-16053319 GTGGAGGGGCGGGATGAGGATGG - Intergenic
1021602776 7:22380605-22380627 GTTGACGGGTGGGATGAGGAGGG + Intergenic
1022113276 7:27244079-27244101 GTGGAGAAGTGGGACTAGGAAGG - Intronic
1022435835 7:30384121-30384143 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1022576308 7:31500531-31500553 ATTGAAAAGTGGAATGTGGAAGG - Intergenic
1022627177 7:32049474-32049496 GAATAAAAGAGGGATGAGGAAGG + Intronic
1022633016 7:32103367-32103389 GTGGAAAGTAGGGGTGAGGATGG + Intronic
1022683218 7:32570185-32570207 AAGGAAAACTGGGATGAGCAGGG - Intronic
1022816882 7:33922569-33922591 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1023214112 7:37842667-37842689 ATGGAAATGTAGGATGAGTATGG - Intronic
1023218418 7:37891699-37891721 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1023706376 7:42945948-42945970 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1023740552 7:43277448-43277470 GCAGATAAGAGGGATGAGGAAGG + Intronic
1024050819 7:45622217-45622239 GGGGAAAATTAGGATGTGGAGGG + Intronic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1024924390 7:54598035-54598057 GCGGAAAAAATGGATGAGGAAGG - Intergenic
1025096669 7:56100998-56101020 GTGGAAAAGAGCGATGAGGAAGG - Intergenic
1025121372 7:56306841-56306863 GTGGAAAAAAGGGATAAGGAAGG + Intergenic
1025235466 7:57231984-57232006 GAGGACAAGTGAGATGAGGTTGG - Intergenic
1027199618 7:76055234-76055256 TTTGAAAAGTAGTATGAGGATGG + Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027787456 7:82598367-82598389 GGGGAATCGTGGGAGGAGGAAGG - Intergenic
1028114257 7:86979895-86979917 GTGGAAAAAAGAGATGAGAAAGG - Intronic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029630473 7:101747228-101747250 GCGGAAAAGAGGGATGAGGAAGG - Intergenic
1031497250 7:122465636-122465658 GTGGAACGGTAGGATGGGGATGG - Intronic
1031917743 7:127578917-127578939 GGGGAAAAGGGGGATGAGGGGGG + Intergenic
1032746312 7:134790130-134790152 AGGGAAAAGGGGGAAGAGGAGGG + Intronic
1033362378 7:140646875-140646897 GTGGGAGAATGGGCTGAGGATGG - Intronic
1033683407 7:143618720-143618742 GGGGAAAAGAGGGATGAGGAAGG + Intergenic
1033701206 7:143838918-143838940 GGGGAAAAGAGGGATGAGGAAGG - Intergenic
1033839422 7:145356260-145356282 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1034382959 7:150714998-150715020 GTGGAAATGTGGGACGGGAAGGG + Intergenic
1034431691 7:151044240-151044262 GTGGATCAGTGGGTTGAGGATGG + Intronic
1034720758 7:153290146-153290168 GAGGAGGAGTGGGAAGAGGAGGG + Intergenic
1034827614 7:154280864-154280886 GTGGAAAAATGGGATAACAATGG - Intronic
1035348668 7:158227103-158227125 GTGGATAAATGGGAGGAGGGAGG + Intronic
1035570170 8:667410-667432 GTGGAGGAGCGGGAAGAGGAGGG - Intronic
1035643304 8:1200010-1200032 GTGGAAAAGTGTGGGGAGGCTGG + Intergenic
1035688755 8:1546453-1546475 ATGGAAACATGGGATAAGGAAGG - Intronic
1035758569 8:2052366-2052388 GAGGGACAGTGGGGTGAGGAGGG + Intronic
1038626425 8:29197676-29197698 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1038927884 8:32160080-32160102 GAGAAATAGTGGGATGATGAAGG + Intronic
1039468788 8:37801270-37801292 GTGGGACAGAGGGATCAGGAAGG - Intronic
1039542098 8:38381485-38381507 TTGGGAAAGTGGGATGGGGGCGG - Intronic
1039600530 8:38833243-38833265 GCGGAAAAGAGGGATGAGGAAGG + Intronic
1041291324 8:56311032-56311054 GTGGAAAGGTGTGAGGAGAATGG + Intronic
1041572512 8:59353248-59353270 GTGGAAAAGTGGAATGAGAAGGG + Intergenic
1041647416 8:60267577-60267599 GCAGAAAAGCGGGATGAAGAGGG + Intronic
1041659822 8:60390984-60391006 GTGGAACAGTGGAAAGAGCATGG - Intergenic
1041669087 8:60475277-60475299 GAGGAAGAGGTGGATGAGGAAGG - Intergenic
1041884480 8:62792662-62792684 AAGGAAAAGTGGATTGAGGAAGG + Intronic
1042708763 8:71691494-71691516 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1043379557 8:79687996-79688018 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1043544726 8:81302419-81302441 ATGGAGAGGTGGGTTGAGGAGGG - Intergenic
1044381514 8:91539618-91539640 GGGGAAAAGAGAGATGAGGGAGG - Intergenic
1044857655 8:96493459-96493481 GAGGAAAAGTGGGGAGAGAAAGG + Exonic
1045130393 8:99145462-99145484 CTGGAAAAGAGGGAGGAGAAAGG - Intronic
1045722820 8:105133736-105133758 AGGGAAAAGTGGGAAGGGGAAGG - Intronic
1045744913 8:105406966-105406988 ATAGAACAGTGGAATGAGGAAGG + Intronic
1045825531 8:106393019-106393041 GTGGAGAAGTTGGAGAAGGATGG - Intronic
1045905373 8:107338447-107338469 GTGGAACAGGAGGGTGAGGAGGG + Intronic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1047389290 8:124437118-124437140 GGGGAAATGAGGGATGAGAAAGG + Intergenic
1047398399 8:124524913-124524935 GGGGAAATGAGGGATGAGAAAGG + Intronic
1048032570 8:130646458-130646480 GAGGAAATGAGGCATGAGGAAGG - Intergenic
1048045083 8:130765428-130765450 GGGGAAAGATGGGATGAGGGTGG + Intergenic
1048262796 8:132959920-132959942 GCAGAAAAGAGTGATGAGGAAGG + Intronic
1048308702 8:133301515-133301537 GTGGAAAAGTGGGGAGACAAAGG - Intronic
1048692693 8:136985903-136985925 GTGGGAAACTGAGATAAGGAAGG - Intergenic
1048799067 8:138179667-138179689 GTGGAGTAGTGTGAGGAGGATGG - Intronic
1049169215 8:141148237-141148259 GTGGAAAGGAGGGAGGAGGGAGG + Intronic
1049464637 8:142745171-142745193 GTGGATAGGTGGGTGGAGGATGG + Intergenic
1049674039 8:143881873-143881895 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050036244 9:1439106-1439128 GTGGAGAAGTGAGATGGGAAAGG + Intergenic
1050057470 9:1671062-1671084 GTGGGATAGTGGAATAAGGAGGG - Intergenic
1050588797 9:7141250-7141272 TGGGAAAAGAGGGATGAGAAAGG - Intergenic
1051370962 9:16358684-16358706 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1052820169 9:33132213-33132235 GTTGTGAAGTGGGAAGAGGAGGG + Intronic
1053163837 9:35830862-35830884 GTTGGAATGTGGGAGGAGGAGGG + Intronic
1053329277 9:37188732-37188754 GGGGAAGAGAGGGGTGAGGAAGG - Intronic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1054936254 9:70691930-70691952 GAGGAAAAGAGGGATGAGGAAGG - Intronic
1055022567 9:71685991-71686013 GTGGAAGAGTGGGAATTGGATGG - Intronic
1055078876 9:72246941-72246963 GCAGAAAAGAGGGATGAGGGAGG - Intronic
1055316551 9:75039837-75039859 GGGGAAGAGAGGGAAGAGGAAGG - Intergenic
1056701759 9:88917120-88917142 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1057008725 9:91583316-91583338 GTGGATGAGTGGGTGGAGGATGG + Intronic
1057079638 9:92163284-92163306 GTTGAGAAGTGGTATGAGGTGGG + Intergenic
1057802147 9:98197130-98197152 GAGAAAAAGGGGGATGAGGGAGG + Intergenic
1058095366 9:100854232-100854254 GAGGAAATGTGAGATGAGGTTGG + Intergenic
1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG + Exonic
1058296223 9:103311412-103311434 CTGGAAAACTGGAATGAGAATGG - Intergenic
1058349399 9:104003421-104003443 GTGGAAAAGGGAGAAGAGGAAGG + Intergenic
1058563045 9:106250141-106250163 GAGGAAGAGGGGGAGGAGGAGGG - Intergenic
1059346529 9:113632651-113632673 GAGGCAAAGTGGGCAGAGGAAGG + Intergenic
1059354234 9:113687092-113687114 GAGGAAAGGAGGGAGGAGGAGGG + Intergenic
1059712408 9:116881125-116881147 GTGGAAGAGGAGGAGGAGGAAGG + Intronic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1060278585 9:122200507-122200529 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1060528657 9:124334735-124334757 GTGGAAAAGCGGGCTGGGGCTGG + Intronic
1060839821 9:126784580-126784602 GGGGAAAAGTGGGCCGGGGACGG - Intergenic
1061025881 9:128049146-128049168 GTGGAGAAGTTGGCTGAGGGCGG + Intergenic
1061370146 9:130193363-130193385 ATGGGAAAGTGGGATGGGGTGGG + Intronic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1062159037 9:135069602-135069624 GGGGAGAGGTGGGAGGAGGAGGG + Intergenic
1062523584 9:136969555-136969577 GTGGAAATGTGGGCTGAGGGTGG - Intronic
1185499183 X:584483-584505 GAGGAAAAAGGGGAGGAGGAGGG + Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185608548 X:1380684-1380706 GAGGAAAAGGGGGAGGAAGAGGG + Intronic
1185913542 X:4009017-4009039 GTGGAAAAGAGAGATAAGGAAGG + Intergenic
1186268014 X:7852497-7852519 GAAGAAAAGAGGGATGAGAAGGG + Intergenic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1187383750 X:18828988-18829010 GTGGAAAAGTGAAAGGAGCAGGG - Intergenic
1187830252 X:23374035-23374057 GTGGAAACGTGAGACAAGGAAGG + Intronic
1188146544 X:26620840-26620862 GGGGAAAAGGGTGAGGAGGATGG + Intergenic
1189141962 X:38616532-38616554 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1189286099 X:39853580-39853602 ATGGAAAGGGGGGAAGAGGAGGG + Intergenic
1189321167 X:40088457-40088479 GGGAAAAAGAGGGAGGAGGAGGG + Intronic
1189426831 X:40909411-40909433 GTGGAAAAGTGGGGGCTGGAGGG + Intergenic
1189585857 X:42461075-42461097 AATGAAAACTGGGATGAGGAAGG + Intergenic
1189830358 X:44966687-44966709 GTGTAATAGGGGGAAGAGGAAGG + Intronic
1189947082 X:46190468-46190490 GAGAAGAAGGGGGATGAGGAGGG - Intergenic
1190177651 X:48164858-48164880 GGGGAAAAGTTGGAAGATGAGGG - Intergenic
1190716843 X:53111745-53111767 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1190722655 X:53162998-53163020 GTGGAAAATTGGGATAGGGCAGG - Intergenic
1191681728 X:63847642-63847664 GTGGAGGAGTGGAATGAGCACGG + Intergenic
1192130117 X:68541900-68541922 ATGGAAAAGTGGGGTGTGGAGGG - Intergenic
1192368861 X:70497273-70497295 GTGCAACACTGGAATGAGGATGG - Intronic
1192433438 X:71127670-71127692 GAGGAAAAGGGGGAAGAGGGTGG - Intronic
1192747180 X:73950825-73950847 GTGGAAAAGATGGAGGAGGCAGG + Intergenic
1193632359 X:83905538-83905560 CTGGTAAGGTGGGATGAGAATGG - Intergenic
1193859789 X:86651223-86651245 GGAGAGAGGTGGGATGAGGATGG + Intronic
1194318460 X:92411915-92411937 GAGGAGGAGTGGGAGGAGGAGGG + Intronic
1194513333 X:94821623-94821645 GTGGGGAAGTGGTATGTGGATGG - Intergenic
1194608062 X:96006004-96006026 GTCCAAACTTGGGATGAGGAAGG + Intergenic
1195100364 X:101549896-101549918 ATTGAAAAGTGGGCTGAGGTGGG - Intergenic
1195835485 X:109110536-109110558 GTGGGAAAGTGGGAGGAGATAGG - Intergenic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196361976 X:114872155-114872177 GTGAATAAATGGGAGGAGGAAGG - Intronic
1196397508 X:115280878-115280900 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197658923 X:129148912-129148934 GAGGAAAAGTGGGCAGTGGAAGG + Intergenic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1199268098 X:145850573-145850595 GTGGAAAATTGGTATAAGAATGG + Intergenic
1199743331 X:150756343-150756365 GTGAAAAAGTGTGGTGGGGAGGG - Intronic
1200068082 X:153514497-153514519 GTGGGAGAGTGGGGTGGGGACGG + Intergenic
1200285337 X:154816946-154816968 CTTAAAAAGTGGGATGAGGTGGG + Intronic
1200626634 Y:5525220-5525242 GAGGAGGAGTGGGAGGAGGAGGG + Intronic
1201474565 Y:14366525-14366547 GATGAAAAGTGGGATTAGGTGGG + Intergenic